rs267606537

Variant names:

• chr11-67487043-AGGGCACCGTGCTGGACGACAGCCG-A
• rs267606537
• NM_003977.4:c.140_163delGCACCGTGCTGGACGACAGCCGGG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_003977.4(AIP):​c.140_163delGCACCGTGCTGGACGACAGCCGGG​(p.Gly47_Arg54del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,730 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. G47G) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: AIP NM_003977.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2 O:1
• Conservation: PhyloP100: 2.10
• Publications: 1 publications found

Genes affected

AIP (HGNC:358): (aryl hydrocarbon receptor interacting protein) The protein encoded by this gene is a receptor for aryl hydrocarbons and a ligand-activated transcription factor. The encoded protein is found in the cytoplasm as part of a multiprotein complex, but upon binding of ligand is transported to the nucleus. This protein can regulate the expression of many xenobiotic metabolizing enzymes. Also, the encoded protein can bind specifically to and inhibit the activity of hepatitis B virus. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]

AIP Gene-Disease associations (from GenCC):

• growth hormone secreting pituitary adenoma 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• familial isolated pituitary adenoma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• pituitary gigantism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• acromegaly

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_003977.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003977.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AIP	NM_003977.4	MANE Select	c.140_163delGCACCGTGCTGGACGACAGCCGGG	p.Gly47_Arg54del	disruptive_inframe_deletion	Exon 2 of 6	NP_003968.3
	AIP	NM_001302960.2		c.140_163delGCACCGTGCTGGACGACAGCCGGG	p.Gly47_Arg54del	disruptive_inframe_deletion	Exon 2 of 6	NP_001289889.1
	AIP	NM_001302959.2		c.-38_-15delGCACCGTGCTGGACGACAGCCGGG		5_prime_UTR	Exon 2 of 6	NP_001289888.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AIP	ENST00000279146.8	TSL:1 MANE Select	c.140_163delGCACCGTGCTGGACGACAGCCGGG	p.Gly47_Arg54del	disruptive_inframe_deletion	Exon 2 of 6	ENSP00000279146.3
	AIP	ENST00000934218.1		c.140_163delGCACCGTGCTGGACGACAGCCGGG	p.Gly47_Arg54del	disruptive_inframe_deletion	Exon 2 of 6	ENSP00000604277.1
	AIP	ENST00000872352.1		c.140_163delGCACCGTGCTGGACGACAGCCGGG	p.Gly47_Arg54del	disruptive_inframe_deletion	Exon 2 of 6	ENSP00000542411.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251330 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000880

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461730 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 727156

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53260

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 8.99e-7 AC: 1 AN: 1112010

Other (OTH) AF: 0.00 AC: 0 AN: 60394

GnomAD4 genome Cov.: 32

Alfa AF: 0.000111 Hom.: 0

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Hereditary cancer-predisposing syndrome (1)
-	1	-	not provided (1)
-	-	-	Somatotroph adenoma (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=6/194	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs267606537; hg19: chr11-67254514;