rs267607475

Variant names:

• chr12-52469683-CCTCCAGCAGCTTGCGGTAGGTGGCGAT-C
• rs267607475
• NM_173086.5:c.1384_1410delATCGCCACCTACCGCAAGCTGCTGGAG

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP3 PP5

The NM_173086.5(KRT6C):​c.1384_1410delATCGCCACCTACCGCAAGCTGCTGGAG​(p.Ile462_Glu470del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: KRT6C NM_173086.5 conservative_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1 O:1
• Conservation: PhyloP100: 8.87
• Publications: 0 publications found

Genes affected

KRT6C (HGNC:20406): (keratin 6C) Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jul 2009]

KRT6C Gene-Disease associations (from GenCC):

• palmoplantar keratoderma, nonepidermolytic, focal or diffuse

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_173086.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 12-52469683-CCTCCAGCAGCTTGCGGTAGGTGGCGAT-C is Pathogenic according to our data. Variant chr12-52469683-CCTCCAGCAGCTTGCGGTAGGTGGCGAT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 66966.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KRT6C	NM_173086.5	c.1384_1410delATCGCCACCTACCGCAAGCTGCTGGAG	p.Ile462_Glu470del	conservative_inframe_deletion	Exon 7 of 9	ENST00000252250.7	NP_775109.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KRT6C	ENST00000252250.7	c.1384_1410delATCGCCACCTACCGCAAGCTGCTGGAG	p.Ile462_Glu470del	conservative_inframe_deletion	Exon 7 of 9	1	NM_173086.5	ENSP00000252250.6

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1 Other:1

Revision: no assertion criteria provided

Submissions by phenotype

Focal palmoplantar keratoderma Pathogenic:1

Feb 01, 2010

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

not provided Other:1

-

Epithelial Biology; Institute of Medical Biology, Singapore

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.9
Mutation Taster		=12/188	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs267607475; hg19: chr12-52863467;