rs267607475
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP3PP5
The NM_173086.5(KRT6C):c.1384_1410delATCGCCACCTACCGCAAGCTGCTGGAG(p.Ile462_Glu470del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_173086.5 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- palmoplantar keratoderma, nonepidermolytic, focal or diffuseInheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_173086.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KRT6C | NM_173086.5 | MANE Select | c.1384_1410delATCGCCACCTACCGCAAGCTGCTGGAG | p.Ile462_Glu470del | conservative_inframe_deletion | Exon 7 of 9 | NP_775109.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KRT6C | ENST00000252250.7 | TSL:1 MANE Select | c.1384_1410delATCGCCACCTACCGCAAGCTGCTGGAG | p.Ile462_Glu470del | conservative_inframe_deletion | Exon 7 of 9 | ENSP00000252250.6 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at