rs267607535
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_021076.4(NEFH):c.2057_2098delCAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG(p.Ala686_Lys699del) variant causes a disruptive inframe deletion change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as risk factor (no stars).
Frequency
Consequence
NM_021076.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Charcot-Marie-Tooth disease axonal type 2CCInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen
- amyotrophic lateral sclerosisInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_021076.4. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes AF: 0.00 AC: 0AN: 141912Hom.: 0 Cov.: 0
GnomAD2 exomes AF: 0.00000797 AC: 2AN: 251064 AF XY: 0.00 show subpopulations
GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0AN: 142018Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0AN XY: 69306
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.