rs606231212

Variant names:

• chr22-29489620-CAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGGCAGAAGCA-C
• rs606231212
• NM_021076.4:c.2057_2098delCAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_021076.4(NEFH):​c.2057_2098delCAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG​(p.Ala686_Lys699del) variant causes a disruptive inframe deletion change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as risk factor (no stars).

• Frequency:
  • Genomes: 𝑓 0.0 (0 hom., cov: 0)
  • Failed GnomAD Quality Control
• Consequence: NEFH NM_021076.4 disruptive_inframe_deletion
• Clinical Significance: risk factor no assertion criteria provided O:2
• Conservation: PhyloP100: 4.71
• Publications: 0 publications found

Genes affected

NEFH (HGNC:7737): (neurofilament heavy chain) Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal damage and susceptibility to amyotrophic lateral sclerosis (ALS) has been associated with mutations in this gene. [provided by RefSeq, Oct 2008]

NEFH Gene-Disease associations (from GenCC):

• Charcot-Marie-Tooth disease axonal type 2CC

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Labcorp Genetics (formerly Invitae)
• amyotrophic lateral sclerosis

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_021076.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_021076.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NEFH	NM_021076.4	MANE Select	c.2057_2098delCAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG	p.Ala686_Lys699del	disruptive_inframe_deletion	Exon 4 of 4	NP_066554.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NEFH	ENST00000310624.7	TSL:1 MANE Select	c.2057_2098delCAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG	p.Ala686_Lys699del	disruptive_inframe_deletion	Exon 4 of 4	ENSP00000311997.6

Frequencies

GnomAD3 genomes AF: 0.00 AC: 0 AN: 141912 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000797 AC: 2 AN: 251064 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000544

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000882

Gnomad OTH exome AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 142018 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 69306

African (AFR) AF: 0.00 AC: 0 AN: 38052

American (AMR) AF: 0.00 AC: 0 AN: 14348

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3366

East Asian (EAS) AF: 0.00 AC: 0 AN: 4742

South Asian (SAS) AF: 0.00 AC: 0 AN: 4346

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9514

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 216

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 64612

Other (OTH) AF: 0.00 AC: 0 AN: 1988

ClinVar

ClinVar submissions as Germline

Significance: risk factor

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	-	-	Amyotrophic lateral sclerosis, susceptibility to (1)
-	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.7
Mutation Taster		=50/150	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs606231212; hg19: chr22-29885609;