rs606231212

Variant names:

• chr22-29489620-CAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGGCAGAAGCA-C
• rs606231212
• NM_021076.4:c.2057_2098delCAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4

The NM_021076.4(NEFH):​c.2057_2098delCAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG​(p.Ala686_Lys699del) variant causes a disruptive inframe deletion change. Variant has been reported in ClinVar as risk factor (no stars).

• Frequency:
  • Genomes: 𝑓 0.0 (0 hom., cov: 0)
  • Failed GnomAD Quality Control
• Consequence: NEFH NM_021076.4 disruptive_inframe_deletion
• Clinical Significance: risk factor no assertion criteria provided O:2
• Conservation: PhyloP100: 4.71

Genes affected

NEFH (HGNC:7737): (neurofilament heavy chain) Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal damage and susceptibility to amyotrophic lateral sclerosis (ALS) has been associated with mutations in this gene. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_021076.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NEFH	NM_021076.4	c.2057_2098delCAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG	p.Ala686_Lys699del	disruptive_inframe_deletion	Exon 4 of 4	ENST00000310624.7	NP_066554.2
NEFH	XM_011530200.3	c.1769_1810delCAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG	p.Ala590_Lys603del	disruptive_inframe_deletion	Exon 5 of 5		XP_011528502.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NEFH	ENST00000310624.7	c.2057_2098delCAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG	p.Ala686_Lys699del	disruptive_inframe_deletion	Exon 4 of 4	1	NM_021076.4	ENSP00000311997.6

Frequencies

GnomAD3 genomes AF: 0.00 AC: 0 AN: 141912 Hom.: 0 Cov.: 0 FAILED QC

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 142018 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 69306

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: risk factor

Submissions summary: Other:2

Revision: no assertion criteria provided

Submissions by phenotype

Amyotrophic lateral sclerosis, susceptibility to Other:1

Feb 01, 1999

OMIM

Significance: risk factor

Review Status: no assertion criteria provided

Collection Method: literature only

- -

not provided Other:1

-

Epithelial Biology; Institute of Medical Biology, Singapore

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs606231212; hg19: chr22-29885609;