rs267608567

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_StrongPM2PP5_Moderate

The NM_001110792.2(MECP2):​c.1135_1154delCACCACCATCACCACCACTC​(p.His379fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

Frequency

Genomes: not found (cov: 22)

Consequence

MECP2
NM_001110792.2 frameshift

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:2

Conservation

PhyloP100: 4.66
Variant links:
Genes affected
MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.242 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant X-154030709-TGAGTGGTGGTGATGGTGGTG-T is Pathogenic according to our data. Variant chrX-154030709-TGAGTGGTGGTGATGGTGGTG-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 143329.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chrX-154030709-TGAGTGGTGGTGATGGTGGTG-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
MECP2NM_001110792.2 linkc.1135_1154delCACCACCATCACCACCACTC p.His379fs frameshift_variant 3/3 ENST00000453960.7 NP_001104262.1 P51608-2A0A140VKC4Q59FJ6
MECP2NM_004992.4 linkc.1099_1118delCACCACCATCACCACCACTC p.His367fs frameshift_variant 4/4 ENST00000303391.11 NP_004983.1 P51608-1D3YJ43Q59FJ6

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
MECP2ENST00000453960.7 linkc.1135_1154delCACCACCATCACCACCACTC p.His379fs frameshift_variant 3/31 NM_001110792.2 ENSP00000395535.2 P51608-2
MECP2ENST00000303391.11 linkc.1099_1118delCACCACCATCACCACCACTC p.His367fs frameshift_variant 4/41 NM_004992.4 ENSP00000301948.6 P51608-1
MECP2ENST00000407218 linkc.*471_*490delCACCACCATCACCACCACTC 3_prime_UTR_variant 4/45 ENSP00000384865.2 B5MCB4
MECP2ENST00000628176 linkc.*471_*490delCACCACCATCACCACCACTC 3_prime_UTR_variant 5/53 ENSP00000486978.1 A0A0D9SFX7

Frequencies

GnomAD3 genomes
Cov.:
22
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
22

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Rett syndrome Pathogenic:2
Likely pathogenic, criteria provided, single submittercurationCentre for Population Genomics, CPGMar 20, 2024This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as likely pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). This variant is absent from gnomAD (PM2_Supporting). -
Pathogenic, no assertion criteria providedcurationRettBASESep 05, 2002- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs267608567; hg19: chrX-153296160; API