rs267608581

Variant names:

• chrX-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAG-T
• rs267608581
• NM_001110792.2:c.1192_1236delCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4

The NM_001110792.2(MECP2):​c.1192_1236delCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC​(p.Leu398_Thr412del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 17)
  • Exomes 𝑓: 0.0000010 (0 hom. 0 hem.)
  • Failed GnomAD Quality Control
• Consequence: MECP2 NM_001110792.2 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:2
• Conservation: PhyloP100: 3.50

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001110792.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1192_1236delCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu398_Thr412del	conservative_inframe_deletion	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1156_1200delCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu386_Thr400del	conservative_inframe_deletion	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1192_1236delCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu398_Thr412del	conservative_inframe_deletion	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1156_1200delCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu386_Thr400del	conservative_inframe_deletion	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes Cov.: 17

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000100 AC: 1 AN: 998687 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 322629

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000128

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 17

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, single submitter

Submissions by phenotype

Rett syndrome Uncertain:2

Mar 18, 2024

Centre for Population Genomics, CPG

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as a variant of uncertain significance. At least the following criteria are met: This variant has been identified as a de novo occurrence in an individual with Rett syndrome without confirmation of paternity and maternity (PM6). PMID: 11309679 -

Feb 15, 2002

RettBASE

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: curation

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs267608581; hg19: chrX-153296078;