rs267608585

Variant names:

• chrX-154030639-CGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-C
• rs267608585
• NM_001110792.2:c.1193_1224delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001110792.2(MECP2):​c.1193_1224delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC​(p.Leu398ArgfsTer8) variant causes a frameshift change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. L398L) has been classified as Benign.

• Frequency: Genomes: not found (cov: 16)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:7
• Conservation: PhyloP100: 5.66
• Publications: 4 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 157 pathogenic variants in the truncated region.
• PP5: Variant X-154030639-CGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-C is Pathogenic according to our data. Variant chrX-154030639-CGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-C is described in ClinVar as Pathogenic. ClinVar VariationId is 143366.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1193_1224delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC	p.Leu398ArgfsTer8	frameshift_variant	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1157_1188delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC	p.Leu386ArgfsTer8	frameshift_variant	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1193_1224delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC	p.Leu398ArgfsTer8	frameshift_variant	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1157_1188delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC	p.Leu386ArgfsTer8	frameshift_variant	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes Cov.: 16

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 16

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:7

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Rett syndrome Pathogenic:4

Mar 16, 2021

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: MECP2 c.1157_1188del32 (p.Leu386ArgfsX8) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The variant was absent in 173875 control chromosomes (gnomAD). c.1157_1188del32 has been reported in the literature in individuals affected with Rett Syndrome (e.g. Zappella_2001, Kammoun_2004, Philippe_2006, Hadzsiev_2011). These data indicate that the variant is likely to be associated with disease. Two ClinVar submitters (evaluation after 2014) cite the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -

Nov 01, 2011

RettBASE

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

Mar 08, 2024

Centre for Population Genomics, CPG

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). (PubMed: 21160487‚Äö 11738860‚Äö 11746022‚Äö 12075485‚Äö 12180070‚Äö 15173251‚Äö 16473305, ClinVar Variation ID: 143366) This variant is absent from gnomAD (PM2_Supporting). -

Jul 16, 2020

Johns Hopkins Genomics, Johns Hopkins University

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This MECP2 variant (rs267608585) is absent in a large population dataset and has an entry in ClinVar. This variant has been reported in patients with classic and variant forms of Rett syndrome. This 32-bp deletion results in a frameshift that is predicted to lead to a premature stop codon (PTC) in the last exon of the gene, likely escaping nonsense-mediated decay and resulting in a truncated protein product. This variant is located within a hotspot of deletions in the C-terminus of the MeCP2 protein, which represent ~12% of disease-associated variants in MECP2. We consider it to be pathogenic. -

not provided Pathogenic:2

Jul 01, 2023

CeGaT Center for Human Genetics Tuebingen

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

MECP2: PS2, PVS1:Strong, PM2 -

Jan 31, 2025

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Published functional studies suggest this variant results in decreased number of neurites and smaller cell sizes in neural cells; however, additional studies are needed to validate the functional effect of this variant (PMID: 21074045); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 12180070, 21074045, 27379379, 12075485, 18562141, 11746022, 21160487, 33168794, 15173251, 16473305, 11738860, 19914908, 28947817) -

Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1

Dec 02, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Leu386Argfs*8) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 101 amino acid(s) of the MECP2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individuals with Rett syndrome (PMID: 11746022, 12075485, 19914908, 21160487). This variant is also known as c.1157_1188del32 and 1157del32. ClinVar contains an entry for this variant (Variation ID: 143366). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.7
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs267608585; hg19: chrX-153296090;