rs267608585
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_StrongPP5_Very_Strong
The NM_001110792.2(MECP2):c.1193_1224delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC(p.Leu398fs) variant causes a frameshift change. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Genomes: not found (cov: 16)
Consequence
MECP2
NM_001110792.2 frameshift
NM_001110792.2 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 5.66
Genes affected
MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.203 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
PP5
Variant X-154030639-CGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-C is Pathogenic according to our data. Variant chrX-154030639-CGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-C is described in ClinVar as [Pathogenic]. Clinvar id is 143366.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chrX-154030639-CGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-C is described in Lovd as [Pathogenic].
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MECP2 | NM_001110792.2 | c.1193_1224delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC | p.Leu398fs | frameshift_variant | 3/3 | ENST00000453960.7 | NP_001104262.1 | |
MECP2 | NM_004992.4 | c.1157_1188delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC | p.Leu386fs | frameshift_variant | 4/4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MECP2 | ENST00000453960.7 | c.1193_1224delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC | p.Leu398fs | frameshift_variant | 3/3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
MECP2 | ENST00000303391.11 | c.1157_1188delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC | p.Leu386fs | frameshift_variant | 4/4 | 1 | NM_004992.4 | ENSP00000301948.6 | ||
MECP2 | ENST00000407218 | c.*529_*560delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC | 3_prime_UTR_variant | 4/4 | 5 | ENSP00000384865.2 | ||||
MECP2 | ENST00000628176 | c.*529_*560delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCC | 3_prime_UTR_variant | 5/5 | 3 | ENSP00000486978.1 |
Frequencies
GnomAD3 genomes Cov.: 16
GnomAD3 genomes
Cov.:
16
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 16
GnomAD4 genome
Cov.:
16
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:6
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Rett syndrome Pathogenic:4
Pathogenic, criteria provided, single submitter | clinical testing | Women's Health and Genetics/Laboratory Corporation of America, LabCorp | Mar 16, 2021 | Variant summary: MECP2 c.1157_1188del32 (p.Leu386ArgfsX8) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The variant was absent in 173875 control chromosomes (gnomAD). c.1157_1188del32 has been reported in the literature in individuals affected with Rett Syndrome (e.g. Zappella_2001, Kammoun_2004, Philippe_2006, Hadzsiev_2011). These data indicate that the variant is likely to be associated with disease. Two ClinVar submitters (evaluation after 2014) cite the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. - |
Pathogenic, criteria provided, single submitter | curation | Centre for Population Genomics, CPG | Mar 08, 2024 | This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). (PubMed: 21160487‚Äö 11738860‚Äö 11746022‚Äö 12075485‚Äö 12180070‚Äö 15173251‚Äö 16473305, ClinVar Variation ID: 143366) This variant is absent from gnomAD (PM2_Supporting). - |
Pathogenic, no assertion criteria provided | curation | RettBASE | Nov 01, 2011 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Johns Hopkins Genomics, Johns Hopkins University | Jul 16, 2020 | This MECP2 variant (rs267608585) is absent in a large population dataset and has an entry in ClinVar. This variant has been reported in patients with classic and variant forms of Rett syndrome. This 32-bp deletion results in a frameshift that is predicted to lead to a premature stop codon (PTC) in the last exon of the gene, likely escaping nonsense-mediated decay and resulting in a truncated protein product. This variant is located within a hotspot of deletions in the C-terminus of the MeCP2 protein, which represent ~12% of disease-associated variants in MECP2. We consider it to be pathogenic. - |
Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Aug 29, 2023 | This sequence change creates a premature translational stop signal (p.Leu386Argfs*8) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 101 amino acid(s) of the MECP2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individuals with Rett syndrome (PMID: 11746022, 12075485, 19914908, 21160487). This variant is also known as c.1157_1188del32 and 1157del32. ClinVar contains an entry for this variant (Variation ID: 143366). For these reasons, this variant has been classified as Pathogenic. - |
not provided Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | CeGaT Center for Human Genetics Tuebingen | Jul 01, 2023 | MECP2: PS2, PVS1:Strong, PM2 - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at