rs267608592

Positions:

• chrX-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGG-T

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_Strong PP5_Very_Strong

The NM_001110792.2(MECP2):​c.1196_1236delCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC​(p.Pro399fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 17)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 3.50

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.201 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PP5: Variant X-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGG-T is Pathogenic according to our data. Variant chrX-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGG-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 143388.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chrX-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGG-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1196_1236delCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Pro399fs	frameshift_variant	3/3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1160_1200delCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Pro387fs	frameshift_variant	4/4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1196_1236delCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Pro399fs	frameshift_variant	3/3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1160_1200delCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Pro387fs	frameshift_variant	4/4	1	NM_004992.4	ENSP00000301948.6
MECP2	ENST00000407218	c.*532_*572delCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC		3_prime_UTR_variant	4/4	5		ENSP00000384865.2
MECP2	ENST00000628176	c.*532_*572delCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC		3_prime_UTR_variant	5/5	3		ENSP00000486978.1

Frequencies

GnomAD3 genomes Cov.: 17

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 17

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Rett syndrome Pathogenic:3

Likely pathogenic, criteria provided, single submitter	curation	Centre for Population Genomics, CPG	Oct 11, 2023	This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 2.0, this variant is classified as likely pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). This variant is absent from gnomAD (PM2_Supporting). -
Pathogenic, no assertion criteria provided	curation	RettBASE	Jun 17, 2004	- -
Pathogenic, no assertion criteria provided	literature only	OMIM	May 01, 2000	- -

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Jul 21, 2015

The c.1160_1200del41 deletion in the MECP2 gene has not been reported previously as a pathogenic variant nor as a benign polymorphism, to our knowledge. The c.1160_1200del41 deletion causes aframeshift starting with codon Proline 387 changes this amino acid to a Glutamine residue, and creates apremature Stop codon at position 4 of the new reading frame, denoted p.Pro387GlnfsX4. This frameshiftvariant replaces the typical last 100 amino acid residues in the MECP2 encoded protein with 4 differentamino acid residues; this change is expected to result in a truncated protein with an altered structure andfunction. Protein truncating variants downstream of this deletion have been reported in the HumanGene Mutation Database in association with MECP2-related disorders (Stenson et al., 2014), supportingthe pathogenicity of more upstream truncating variants. The c.1160_1200del41 deletion was notobserved in approximately 6500 individuals of European and African American ancestry in the NHLBIExome Sequencing Project, indicating it is not a common benign variant in these populations. We interpret c.1160_1200del41 as a pathogenic variant. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs267608592; hg19: chrX-153296078;