rs273900724

Variant names:

• chr17-43090922-CACACACACACACGCTTTTTA-T
• rs273900724
• NM_007294.4:c.4185+2_4185+22delTAAAAAGCGTGTGTGTGTGTGinsA

Variant summary

Our verdict is Pathogenic. The variant received 20 ACMG points: 20P and 0B. PVS1 PS3 PP5_Very_Strong

The NM_007294.4(BRCA1):​c.4185+2_4185+22delTAAAAAGCGTGTGTGTGTGTGinsA variant causes a splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). ClinVar reports functional evidence for this variant: "SCV000272963: RNA studies have demonstrated that this alteration results in abnormal splicing (Ambry internal data" and additional evidence is available in ClinVar. The gene BRCA1 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 32)
• Consequence: BRCA1 NM_007294.4 splice_donor, splice_region, intron
• Clinical Significance: Pathogenic reviewed by expert panel P:12
• Conservation: PhyloP100: 2.15
• Publications: 5 publications found

Genes affected

BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]

BRCA1 Gene-Disease associations (from GenCC):

• BRCA1-related cancer predisposition

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• breast-ovarian cancer, familial, susceptibility to, 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
• Fanconi anemia, complementation group S

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae), Ambry Genetics
• pancreatic cancer, susceptibility to, 4

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary breast ovarian cancer syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fanconi anemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for BRCA1 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Pathogenic. The variant received 20 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, Cryptic splice site detected, with MaxEntScore 3.7, offset of 37, new splice context is: gtaGTatgt. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
• PS3: PS3 evidence extracted from ClinVar submissions: SCV000272963: RNA studies have demonstrated that this alteration results in abnormal splicing (Ambry internal data; Meyer P et al. Hum Mutat, 2003 Sep;22:259).; SCV000688473: Functional RNA studies have shown that this variant causes the retention of intron 11, resulting in premature truncation and is expected to result in an absent or non-functional protein product (PMID: 12938098).; SCV000635953: Studies have shown that disruption of this splice site results in retention of intron 11, and produces a non-functional protein and/or introduces a premature termination codon (PMID: 12938098).; SCV001361836: The variant was absent in 250278 control chromosomes (gnomAD). c.4185+2_4185+22delinsA has been reported in the literature in multiple individuals affected with Hereditary Breast and Ovarian Cancer (Meyer_2003, Rebbeck_2018). These data indicate that the variant is very likely to be associated with disease. **At least one publication reports experimental evidence that this variant affects mRNA splicing (Meyer_2003).** no
• PP5: Variant 17-43090922-CACACACACACACGCTTTTTA-T is Pathogenic according to our data. Variant chr17-43090922-CACACACACACACGCTTTTTA-T is described in ClinVar as Pathogenic. ClinVar VariationId is 37574.Status of the report is reviewed_by_expert_panel, 3 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007294.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BRCA1	NM_007294.4	MANE Select	c.4185+2_4185+22delTAAAAAGCGTGTGTGTGTGTGinsA		splice_donor splice_region intron	N/A	NP_009225.1	P38398-1
	BRCA1	NM_001407581.1		c.4185+2_4185+22delTAAAAAGCGTGTGTGTGTGTGinsA		splice_donor splice_region intron	N/A	NP_001394510.1	A0A2R8Y7V5
	BRCA1	NM_001407582.1		c.4185+2_4185+22delTAAAAAGCGTGTGTGTGTGTGinsA		splice_donor splice_region intron	N/A	NP_001394511.1	A0A2R8Y7V5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BRCA1	ENST00000357654.9	TSL:1 MANE Select	c.4185+2_4185+22delTAAAAAGCGTGTGTGTGTGTGinsA		splice_donor splice_region intron	N/A	ENSP00000350283.3	P38398-1
	BRCA1	ENST00000471181.7	TSL:1	c.4185+2_4185+22delTAAAAAGCGTGTGTGTGTGTGinsA		splice_donor splice_region intron	N/A	ENSP00000418960.2	P38398-7
	BRCA1	ENST00000470026.6	TSL:1	c.4185+2_4185+22delTAAAAAGCGTGTGTGTGTGTGinsA		splice_donor splice_region intron	N/A	ENSP00000419274.2	P38398-1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
5	-	-	Breast-ovarian cancer, familial, susceptibility to, 1 (5)
3	-	-	Hereditary breast ovarian cancer syndrome (3)
2	-	-	Hereditary cancer-predisposing syndrome (2)
2	-	-	not provided (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs273900724; hg19: chr17-41242939;