rs281865194

Variant names:

• chrX-41473528-GGCCTGCGCCCGCGCTTGTCCCGCC-G
• rs281865194
• NM_001378477.3:c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 9P and 1B. PP3 PP5_Very_Strong BP3

The NM_001378477.3(NYX):​c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC​(p.Arg24_Ala31del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000018 in 110,973 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 1 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000018 (0 hom., 1 hem., cov: 23)
  • Exomes 𝑓: 0.0000056 (0 hom. 4 hem.)
  • Failed GnomAD Quality Control
• Consequence: NYX NM_001378477.3 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:7 O:1
• Conservation: PhyloP100: 9.69
• Publications: 0 publications found

Genes affected

NYX (HGNC:8082): (nyctalopin) The product of this gene belongs to the small leucine-rich proteoglycan (SLRP) family of proteins. Defects in this gene are the cause of congenital stationary night blindness type 1 (CSNB1), also called X-linked congenital stationary night blindness (XLCSNB). CSNB1 is a rare inherited retinal disorder characterized by impaired scotopic vision, myopia, hyperopia, nystagmus and reduced visual acuity. The role of other SLRP proteins suggests that mutations in this gene disrupt developing retinal interconnections involving the ON-bipolar cells, leading to the visual losses seen in patients with complete CSNB. [provided by RefSeq, Oct 2008]

NYX Gene-Disease associations (from GenCC):

• congenital stationary night blindness 1A

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• NYX-related retinopathy

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• congenital stationary night blindness

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-41473528-GGCCTGCGCCCGCGCTTGTCCCGCC-G is Pathogenic according to our data. Variant chrX-41473528-GGCCTGCGCCCGCGCTTGTCCCGCC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 99841.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BP3: Nonframeshift variant in repetitive region in NM_001378477.3

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001378477.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NYX	NM_001378477.3	MANE Select	c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC	p.Arg24_Ala31del	conservative_inframe_deletion	Exon 3 of 3	NP_001365406.2	Q9GZU5
	NYX	NM_022567.3		c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC	p.Arg24_Ala31del	conservative_inframe_deletion	Exon 2 of 2	NP_072089.2	Q9GZU5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NYX	ENST00000378220.3	TSL:1 MANE Select	c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC	p.Arg24_Ala31del	conservative_inframe_deletion	Exon 3 of 3	ENSP00000367465.2	Q9GZU5
	NYX	ENST00000342595.3	TSL:1	c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC	p.Arg24_Ala31del	conservative_inframe_deletion	Exon 2 of 2	ENSP00000340328.3	Q9GZU5
	NYX	ENST00000938151.1		c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC	p.Arg24_Ala31del	conservative_inframe_deletion	Exon 3 of 3	ENSP00000608210.1

Frequencies

GnomAD3 genomes AF: 0.0000180 AC: 2 AN: 110973 Hom.: 0 Cov.: 23

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000381

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000564 AC: 5 AN: 886556 Hom.: 0 AF XY: 0.0000149 AC XY: 4 AN XY: 267588

African (AFR) AF: 0.0000558 AC: 1 AN: 17908

American (AMR) AF: 0.00 AC: 0 AN: 8836

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 11892

East Asian (EAS) AF: 0.00 AC: 0 AN: 18915

South Asian (SAS) AF: 0.00 AC: 0 AN: 31493

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 22104

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2298

European-Non Finnish (NFE) AF: 0.00000543 AC: 4 AN: 736946

Other (OTH) AF: 0.00 AC: 0 AN: 36164

GnomAD4 genome AF: 0.0000180 AC: 2 AN: 110973 Hom.: 0 Cov.: 23 AF XY: 0.0000299 AC XY: 1 AN XY: 33499

African (AFR) AF: 0.00 AC: 0 AN: 30782

American (AMR) AF: 0.00 AC: 0 AN: 10612

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2631

East Asian (EAS) AF: 0.00 AC: 0 AN: 3518

South Asian (SAS) AF: 0.00 AC: 0 AN: 2773

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 5734

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 236

European-Non Finnish (NFE) AF: 0.0000381 AC: 2 AN: 52528

Other (OTH) AF: 0.00 AC: 0 AN: 1492

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000151

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
4	-	-	not provided (5)
2	-	-	Congenital stationary night blindness 1A (2)
1	-	-	Retinal dystrophy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.7
Mutation Taster		=39/161	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs281865194; hg19: chrX-41332781;