rs281865194

Variant names:

• chrX-41473528-GGCCTGCGCCCGCGCTTGTCCCGCC-G
• rs281865194
• NM_001378477.3:c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 11P and 1B. PM2 PP3 PP5_Very_Strong BP3

The NM_001378477.3(NYX):​c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC​(p.Arg24_Ala31del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000018 in 110,973 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 1 hemizygotes in GnomAD. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000018 (0 hom., 1 hem., cov: 23)
  • Exomes 𝑓: 0.0000056 (0 hom. 4 hem.)
  • Failed GnomAD Quality Control
• Consequence: NYX NM_001378477.3 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:7 O:1
• Conservation: PhyloP100: 9.69

Genes affected

NYX (HGNC:8082): (nyctalopin) The product of this gene belongs to the small leucine-rich proteoglycan (SLRP) family of proteins. Defects in this gene are the cause of congenital stationary night blindness type 1 (CSNB1), also called X-linked congenital stationary night blindness (XLCSNB). CSNB1 is a rare inherited retinal disorder characterized by impaired scotopic vision, myopia, hyperopia, nystagmus and reduced visual acuity. The role of other SLRP proteins suggests that mutations in this gene disrupt developing retinal interconnections involving the ON-bipolar cells, leading to the visual losses seen in patients with complete CSNB. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-41473528-GGCCTGCGCCCGCGCTTGTCCCGCC-G is Pathogenic according to our data. Variant chrX-41473528-GGCCTGCGCCCGCGCTTGTCCCGCC-G is described in ClinVar as [Pathogenic]. Clinvar id is 99841.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chrX-41473528-GGCCTGCGCCCGCGCTTGTCCCGCC-G is described in Lovd as [Likely_pathogenic].
• BP3: Nonframeshift variant in repetitive region in NM_001378477.3

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NYX	NM_001378477.3	c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC	p.Arg24_Ala31del	conservative_inframe_deletion	Exon 3 of 3	ENST00000378220.3	NP_001365406.2
NYX	NM_022567.3	c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC	p.Arg24_Ala31del	conservative_inframe_deletion	Exon 2 of 2		NP_072089.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NYX	ENST00000378220.3	c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC	p.Arg24_Ala31del	conservative_inframe_deletion	Exon 3 of 3	1	NM_001378477.3	ENSP00000367465.2
NYX	ENST00000342595.3	c.70_93delCGCGCTTGTCCCGCCGCCTGCGCC	p.Arg24_Ala31del	conservative_inframe_deletion	Exon 2 of 2	1		ENSP00000340328.3
NYX	ENST00000486842.1	n.323_346delCGCGCTTGTCCCGCCGCCTGCGCC		non_coding_transcript_exon_variant	Exon 2 of 2	3

Frequencies

GnomAD3 genomes AF: 0.0000180 AC: 2 AN: 110973 Hom.: 0 Cov.: 23 AF XY: 0.0000299 AC XY: 1 AN XY: 33499

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000381

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000564 AC: 5 AN: 886556 Hom.: 0 AF XY: 0.0000149 AC XY: 4 AN XY: 267588

Gnomad4 AFR exome AF: 0.0000558

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000543

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000180 AC: 2 AN: 110973 Hom.: 0 Cov.: 23 AF XY: 0.0000299 AC XY: 1 AN XY: 33499

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000381

Gnomad4 OTH AF: 0.00

Bravo AF: 0.0000151

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:7 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:4 Other:1

Mar 20, 2023

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame deletion of 8 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: (PMID: 18617546, 11062471, 19578023) -

Jan 21, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.85_108del, results in the deletion of 8 amino acid(s) of the NYX protein (p.Arg29_Ala36del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs281865194, gnomAD 0.01%). This variant has been observed in individuals with congenital stationary night blindness (PMID: 11062471, 19578023). It has also been observed to segregate with disease in related individuals. This variant is also known as 85–108del24nt (RACPAACA29-36del). ClinVar contains an entry for this variant (Variation ID: 99841). For these reasons, this variant has been classified as Pathogenic. -

-

Retina International

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Oct 23, 2020

Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jul 21, 2015

Eurofins Ntd Llc (ga)

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Congenital stationary night blindness 1A Pathogenic:2

Nov 01, 2000

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

May 08, 2024

Clinical Genomics Laboratory, Washington University in St. Louis

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The NYX c.85_108del (p.Arg29_Ala36del) variant has been reported in 29 individuals in eight families with X-linked complete congenital stationary night blindness (Bech-Hansen NT et al., PMID: 11062471; Zeitz C et al., PMID: 19578023). A genotype analysis of the X chromosomes with this deletion suggest that this is a common founder mutation. This variant is only observed on 1/19,558 alleles in the general population (gnomAD v.2.1.1), indicating it is not a common variant. This variant is predicted to cause a change in the length of the protein due to an in-frame deletion of eight amino acids in a non-repeat region. This variant has been reported in the ClinVar database as a germline pathogenic variant by six submitters. Based on available information and the ACMG/AMP guidelines for variant interpretation (Richards S et al., PMID: 25741868), this variant is classified as pathogenic. -

Retinal dystrophy Pathogenic:1

Jul 19, 2019

Blueprint Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs281865194; hg19: chrX-41332781;