rs281865371
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_000330.4(RS1):c.658_*7delGTCAGCAAGTGTGCCTGATGCCTGC(p.Val220fs) variant causes a frameshift, stop lost change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars). The gene RS1 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000330.4 frameshift, stop_lost
Scores
Clinical Significance
Conservation
Publications
- CDKL5 disorderInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- developmental and epileptic encephalopathy, 2Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- genetic developmental and epileptic encephalopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- infantile spasmsInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- precocious pubertyInheritance: XL Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000330.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RS1 | MANE Select | c.658_*7delGTCAGCAAGTGTGCCTGATGCCTGC | p.Val220fs | frameshift stop_lost | Exon 6 of 6 | NP_000321.1 | O15537 | ||
| RS1 | MANE Select | c.658_*7delGTCAGCAAGTGTGCCTGATGCCTGC | 3_prime_UTR | Exon 6 of 6 | NP_000321.1 | O15537 | |||
| CDKL5 | c.2714-4007_2714-3983delGGCATCAGGCACACTTGCTGACGCA | intron | N/A | NP_001032420.1 | O76039-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RS1 | TSL:1 MANE Select | c.658_*7delGTCAGCAAGTGTGCCTGATGCCTGC | p.Val220fs | frameshift stop_lost | Exon 6 of 6 | ENSP00000369320.3 | O15537 | ||
| RS1 | TSL:1 MANE Select | c.658_*7delGTCAGCAAGTGTGCCTGATGCCTGC | 3_prime_UTR | Exon 6 of 6 | ENSP00000369320.3 | O15537 | |||
| CDKL5 | TSL:1 | c.2714-4007_2714-3983delGGCATCAGGCACACTTGCTGACGCA | intron | N/A | ENSP00000369325.3 | O76039-1 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 genome Cov.: 23
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at