rs281874736
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3
The NM_033380.3(COL4A5):c.4344_4379dupTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGG(p.Gly1460_Thr1461insProAspGlyLeuGlnGlyProProGlyProProGly) variant causes a disruptive inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_033380.3 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Alport syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P, ClinGen
- X-linked Alport syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Myriad Women's Health
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_033380.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A5 | MANE Select | c.4344_4379dupTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGG | p.Gly1460_Thr1461insProAspGlyLeuGlnGlyProProGlyProProGly | disruptive_inframe_insertion | Exon 49 of 53 | NP_203699.1 | P29400-2 | ||
| COL4A5 | c.4326_4361dupTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGG | p.Gly1454_Thr1455insProAspGlyLeuGlnGlyProProGlyProProGly | disruptive_inframe_insertion | Exon 47 of 51 | NP_000486.1 | P29400-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A5 | TSL:1 MANE Select | c.4344_4379dupTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGG | p.Gly1460_Thr1461insProAspGlyLeuGlnGlyProProGlyProProGly | disruptive_inframe_insertion | Exon 49 of 53 | ENSP00000331902.7 | P29400-2 | ||
| COL4A5 | c.4338_4373dupTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGG | p.Gly1458_Thr1459insProAspGlyLeuGlnGlyProProGlyProProGly | disruptive_inframe_insertion | Exon 47 of 51 | ENSP00000619202.1 | ||||
| COL4A5 | TSL:2 | c.4326_4361dupTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGG | p.Gly1454_Thr1455insProAspGlyLeuGlnGlyProProGlyProProGly | disruptive_inframe_insertion | Exon 47 of 51 | ENSP00000354505.2 | P29400-1 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 exome Cov.: 30
GnomAD4 genome Cov.: 23
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.