rs3217060

Variant names:

• chr11-64304830-CGTGACCTTCATTCGGTCACCGCA-C
• rs3217060
• NM_001039496.2:c.*185_*207delGTGACCTTCATTCGGTCACCGCA

Your query was ambiguous. Multiple possible variants found:

• chr11-64304830-CGTGACCTTCATTCGGTCACCGCA-C
• chr11-64304830-CGTGACCTTCATTCGGTCACCGCA-CGTGACCTTCATTCGGTCACCGCAGTGACCTTCATTCGGTCACCGCA
• chr11-64304830-CGTGACCTTCATTCGGTCACCGCA-CGTGACCTTCATTCGGTCACCGCAGTGACCTTCATTCGGTCACCGCAGTGACCTTCATTCGGTCACCGCA
• chr11-64304830-CGTGACCTTCATTCGGTCACCGCA-CGTGACCTTCATTCGGTCACCGCAGTGACCTTCATTCGGTCACCGCAGTGACCTTCATTCGGTCACCGCAGTGACCTTCATTCGGTCACCGCA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001039496.2(CATSPERZ):​c.*185_*207delGTGACCTTCATTCGGTCACCGCA variant causes a downstream gene change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00103 in 544,824 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0010 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0010 (1 hom.)
• Consequence: CATSPERZ NM_001039496.2 downstream_gene
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.922
• Publications: 1 publications found

Genes affected

CATSPERZ (HGNC:19231): (catsper channel auxiliary subunit zeta) Predicted to be involved in flagellated sperm motility; male meiotic nuclear division; and sperm capacitation. Located in cytoplasm and sperm principal piece. [provided by Alliance of Genome Resources, Apr 2022]

KCNK4-CATSPERZ (HGNC:56753): (KCNK4-CATSPERZ readthrough (NMD candidate)) This locus represents naturally occurring readthrough transcription between the neighboring KCNK4 (potassium channel subfamily K member 4) and the downstream TEX40 (testis expressed 40) chromosome 11. The readthrough transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Nov 2015]

ESRRA (HGNC:3471): (estrogen related receptor alpha) The protein encoded by this gene is a nuclear receptor that is most closely related to the estrogen receptor. This protein acts as a site-specific transcription factor and interacts with members of the PGC-1 family of transcription cofactors to regulate the expression of most genes involved in cellular energy production as well as in the process of mitochondrial biogenesis. A processed pseudogene of ESRRA is located on chromosome 13q12.1. [provided by RefSeq, Jun 2019]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001039496.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CATSPERZ	NM_001039496.2	MANE Select	c.*185_*207delGTGACCTTCATTCGGTCACCGCA		downstream_gene	N/A	NP_001034585.1	Q9NTU4
	KCNK4-CATSPERZ	NR_133662.1		n.*62_*84delGTGACCTTCATTCGGTCACCGCA		downstream_gene	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CATSPERZ	ENST00000328404.8	TSL:1 MANE Select	c.*185_*207delGTGACCTTCATTCGGTCACCGCA		downstream_gene	N/A	ENSP00000491717.1	Q9NTU4
	KCNK4-CATSPERZ	ENST00000539086.5	TSL:1	n.*62_*84delGTGACCTTCATTCGGTCACCGCA		downstream_gene	N/A
	ESRRA	ENST00000965463.1		c.-343_-321delGTGACCTTCATTCGGTCACCGCA		upstream_gene	N/A	ENSP00000635522.1

Frequencies

GnomAD3 genomes AF: 0.00103 AC: 155 AN: 150064 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00146

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000924

Gnomad ASJ AF: 0.00262

Gnomad EAS AF: 0.000789

Gnomad SAS AF: 0.00276

Gnomad FIN AF: 0.0000958

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000791

Gnomad OTH AF: 0.000484

GnomAD4 exome AF: 0.00103 AC: 407 AN: 394644 Hom.: 1 AF XY: 0.00128 AC XY: 265 AN XY: 207798

African (AFR) AF: 0.000791 AC: 9 AN: 11380

American (AMR) AF: 0.000320 AC: 5 AN: 15642

Ashkenazi Jewish (ASJ) AF: 0.00279 AC: 33 AN: 11824

East Asian (EAS) AF: 0.0000371 AC: 1 AN: 26970

South Asian (SAS) AF: 0.00451 AC: 174 AN: 38604

European-Finnish (FIN) AF: 0.0000771 AC: 2 AN: 25926

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 1872

European-Non Finnish (NFE) AF: 0.000710 AC: 170 AN: 239414

Other (OTH) AF: 0.000565 AC: 13 AN: 23012

GnomAD4 genome AF: 0.00103 AC: 155 AN: 150180 Hom.: 0 Cov.: 32 AF XY: 0.00109 AC XY: 80 AN XY: 73364

African (AFR) AF: 0.00146 AC: 60 AN: 41086

American (AMR) AF: 0.000923 AC: 14 AN: 15168

Ashkenazi Jewish (ASJ) AF: 0.00262 AC: 9 AN: 3432

East Asian (EAS) AF: 0.000791 AC: 4 AN: 5060

South Asian (SAS) AF: 0.00276 AC: 13 AN: 4712

European-Finnish (FIN) AF: 0.0000958 AC: 1 AN: 10442

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.000791 AC: 53 AN: 67006

Other (OTH) AF: 0.000478 AC: 1 AN: 2090

Alfa AF: 0.000125 Hom.: 22

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.92

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3217060; hg19: chr11-64072302;