rs36212066

Variant names:

• chr11-47332274-AGAGAGGGAGGGAAGCCATCCAGGCT-A
• rs36212066
• NM_000256.3:c.3628-41_3628-17delAGCCTGGATGGCTTCCCTCCCTCTC

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BS1_Supporting BS2

The NM_000256.3(MYBPC3):​c.3628-41_3628-17delAGCCTGGATGGCTTCCCTCCCTCTC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00185 in 1,613,290 control chromosomes in the GnomAD database, including 67 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.0012 (3 hom., cov: 33)
  • Exomes 𝑓: 0.0019 (64 hom.)
• Consequence: MYBPC3 NM_000256.3 intron
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:4 U:5 B:7
• Conservation: PhyloP100: 1.38
• Publications: 10 publications found

Genes affected

MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

MYBPC3 Gene-Disease associations (from GenCC):

• hypertrophic cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• hypertrophic cardiomyopathy 4

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
• left ventricular noncompaction 10

  Inheritance: AR, AD Classification: DEFINITIVE, MODERATE, LIMITED Submitted by: Ambry Genetics
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• atrial fibrillation

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• dilated cardiomyopathy

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.00118 (179/152326) while in subpopulation SAS AF = 0.0361 (174/4826). AF 95% confidence interval is 0.0317. There are 3 homozygotes in GnomAd4. There are 140 alleles in the male GnomAd4 subpopulation. Median coverage is 33. This position passed quality control check. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting
• BS2: High Homozygotes in GnomAd4 at 3 AR,AD gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYBPC3	NM_000256.3	c.3628-41_3628-17delAGCCTGGATGGCTTCCCTCCCTCTC		intron_variant	Intron 32 of 34	ENST00000545968.6	NP_000247.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYBPC3	ENST00000545968.6	c.3628-41_3628-17delAGCCTGGATGGCTTCCCTCCCTCTC		intron_variant	Intron 32 of 34	5	NM_000256.3	ENSP00000442795.1
MYBPC3	ENST00000399249.6	c.3628-41_3628-17delAGCCTGGATGGCTTCCCTCCCTCTC		intron_variant	Intron 31 of 33	5		ENSP00000382193.2

Frequencies

GnomAD3 genomes AF: 0.00116 AC: 177 AN: 152208 Hom.: 3 Cov.: 33

Gnomad AFR AF: 0.0000482

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000654

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000384

Gnomad SAS AF: 0.0356

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00401 AC: 997 AN: 248518 AF XY: 0.00549

Gnomad AFR exome AF: 0.0000648

Gnomad AMR exome AF: 0.0000870

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000167

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000890

Gnomad OTH exome AF: 0.00132

GnomAD4 exome AF: 0.00193 AC: 2813 AN: 1460964 Hom.: 64 AF XY: 0.00282 AC XY: 2051 AN XY: 726800

African (AFR) AF: 0.0000597 AC: 2 AN: 33480

American (AMR) AF: 0.0000671 AC: 3 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26128

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39694

South Asian (SAS) AF: 0.0311 AC: 2682 AN: 86234

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52974

Middle Eastern (MID) AF: 0.00104 AC: 6 AN: 5762

European-Non Finnish (NFE) AF: 0.00000540 AC: 6 AN: 1111620

Other (OTH) AF: 0.00187 AC: 113 AN: 60350

GnomAD4 genome AF: 0.00118 AC: 179 AN: 152326 Hom.: 3 Cov.: 33 AF XY: 0.00188 AC XY: 140 AN XY: 74492

African (AFR) AF: 0.0000481 AC: 2 AN: 41580

American (AMR) AF: 0.0000653 AC: 1 AN: 15306

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.000385 AC: 2 AN: 5190

South Asian (SAS) AF: 0.0361 AC: 174 AN: 4826

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10630

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68004

Other (OTH) AF: 0.00 AC: 0 AN: 2112

Alfa AF: 0.000391 Hom.: 0

Bravo AF: 0.000230

Asia WGS AF: 0.0170 AC: 58 AN: 3478

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:4 Uncertain:5 Benign:7

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Hypertrophic cardiomyopathy 4 Pathogenic:1 Uncertain:2 Benign:1

Feb 08, 2017

Agnes Ginges Centre for Molecular Cardiology, Centenary Institute

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: research

This variant has been identified as part of our research program. Refer to the 'condition' field for the phenotype of the proband(s) identified with this variant. For further information please feel free to contact us. -

Aug 02, 2023

3billion

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The variant is observed at an extremely low frequency in the gnomAD v2.1.1 dataset (total allele frequency: 0.003%). Predicted Consequence/Location: Intron variant In silico tools predict the variant to alter splicing and produce an abnormal transcript [SpliceAI: 0.99 (>=0.2, moderate evidence for spliceogenicity)]. The variant has been observed in multiple (>3) similarly affected unrelated individuals (PMID: 30025578, 32163302, 32396390). The variant has been reported to co-segregate with the disease in at least one similarly affected relative/individual in the same family or similarly affected unrelated family (PMID: 32396390). The variant has been reported at least twice as pathogenic with clinical assertions and evidence for the classification (ClinVar ID: VCV000188544 /PMID: 30025578). Therefore, this variant is classified as Pathogenic according to the recommendation of ACMG/AMP guideline. -

Oct 31, 2024

Mendelics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The NM_000256.3(MYBPC3):c.3628-41_3628-17del variant (rs36212066) has a GnomAD 4.1.0 frequency of 0.001855 (2992 heterozygotes) with 67 homozygotes. This frequency and the number of homozygotes are not compatible to a variant causing the disease. -

Mar 12, 2020

Clinical Genomics Laboratory, Stanford Medicine

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The c.3628-41_3628-17del25 variant in the MYBPC3 gene has been previously reported in the heterozygous, compound heterozygous, or homozygous state in >30 unrelated individuals with cardiomyopathy (Alfares et al., 2015; Bashyam et al., 2012; Dhandapany et al., 2009; Waldmuller et al., 2003). The c.3628-41_3628-17del25 variant has also been identified in 981/30,592 South Asian chromosomes, including 19 homozygotes, by the Genome Aggregation Database (http://gnomad.broadinstitute.org/), indicating it may be a common, reduced penetrance allele in this population. While the c.3628-41_3628-17del25 variant is relatively common in individuals of South Asian ancestry, case-control studies have found an associated risk with cardiomyopathy (Dhandapany et al., 2009). This variant is predicted to disrupt splicing and lead to skipping of exon 33, reducing the length of the protein (Dhandapany et al., 2009; Waldmuller et al., 2003). These data were assessed using the ACMG/AMP variant interpretation guidelines. In summary, there is sufficient evidence to classify the c.3628-41_3628- 17del25 variant as likely pathogenic with reduced penetrance for hypertrophic cardiomyopathy in an autosomal dominant manner based on the information above. [ACMG evidence codes used: PS4; PM4] -

Cardiomyopathy Uncertain:2 Benign:1

Mar 24, 2020

Color Diagnostics, LLC DBA Color Health

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jun 02, 2023

CHEO Genetics Diagnostic Laboratory, Children's Hospital of Eastern Ontario

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jun 11, 2020

Victorian Clinical Genetics Services, Murdoch Childrens Research Institute

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Based on the classification scheme VCGS_Germline_v1.1.1, this variant is classified as 3C-VUS. Following criteria are met: 0102 - Loss-of-function is a known mechanism of disease for this gene. (N) 0108 - This gene is known to be associated with both recessive and dominant disease. Heterozygous variants are frequently reported in adult onset conditions, however, recessive inheritance results in a more severe early onset phenotype (OMIM). (N) 0205 – Intronic deletion variant that is predicted to result in a splicing and a truncated protein, with less than 1/3 of the protein affected. (P) 0210 - Splice site variant (canonical or non-canonical) proven to affect splicing/expression of the transcript with a known effect on protein structure. Sequencing of the mRNA from carriers of this variant demonstrated exon 33 skipping. (N) 0251 - Variant is heterozygous. (N) 0308 - Population frequency for this variant in gnomAD is out of keeping with known incidence of cardiomyopathy (962 heterozygotes, 19 homozygotes). (B) 0701 - Comparable variants have very strong previous evidence for pathogenicity. Multiple truncating variants have been reported downstream of this variant (ClinVar). (P) 0801 - Strong previous evidence of pathogenicity in unrelated individuals. More than 10 heterozygotes and homozygotes with cardiomyopathy have been reported with this variant. However, the homozygous deletion was also found in normal individuals (PMID: 19151713). (P) 1002 - Moderate functional evidence supporting abnormal protein function. Expression of this variant in neonatal rat cardiomyocytes highly disorganized and diffused pattern of sarcometric architecture and expression of a protein with lower molecular weight (PMID: 19151713). (P) 1208 - Inheritance information for this variant is not currently available. (N) Legend: (P) - Pathogenic, (N) - Neutral, (B) - Benign -

not provided Pathogenic:1 Benign:1

Feb 22, 2022

AiLife Diagnostics, AiLife Diagnostics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Feb 02, 2024

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

See Variant Classification Assertion Criteria. -

not specified Benign:2

Aug 14, 2020

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.3628-41_3628-17del variant in MYBPC3 has been identified in 3.2% (981/30592) of South Asian chromosomes, including 19 homozygotes, by gnomAD (http://gnomad.broadinstitute.org). This variant has been previously considered to be a common low-penetrance variant associated with milder, late-onset HCM in the heterozygote state, or early-onset disease in an autosomal recessive manner (Dhandapany 2009 PMID: 19151713, Waldmuller 2003 PMID: 12788380, Tanjore 2008 PMID: 18273486, Bashyam 2012 PMID: 21959974). A recent report has shown that this variant is not directly associated to cardiomyopathy but rather is in tight linkage disequilibrium with a rare intronic pathogenic MYBPC3 variant (c.1224-52G>A) that is reported to be one of the most frequent pathogenic variants associated to HCM in both Europeans and South Asians (Harper 2020 PMID: 32163302). Thus, the risk previously attributed to this variant can be explained by the intronic c.1224-52G>A variant. In summary, this variant is classified as likely benign. ACMG/AMP Criteria applied: BS1, BP2. -

Mar 12, 2021

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: MYBPC3 c.3628-41_3628-17del25 (also reported as the MYBPC3 delta25 variant) alters a non-conserved nucleotide located close to a canonical splice site and therefore could affect mRNA splicing, leading to a significantly altered protein sequence. 4/4 computational tools predict no significant impact on normal splicing. In contrast, early publications demonstrated that the variant affects normal splicing leading to skipping of exon 33 and a loss of 62 amino acids that modified the C10 domain of the MYBPC3 protein (Waldmuller_2003, Dhandapany_2009). However, both residual normally spliced and deleted transcripts were reported in these studies, therefore the exact in-vivo consequence of this finding remains questionable in light of additional reports summarized below. The variant allele was found at a frequency of 0.004 in 250036 control chromosomes, predominantly at a frequency of 0.032 within the South Asian subpopulation in the gnomAD database, including 19 homozygotes. The observed variant frequency within South Asian control individuals in the gnomAD database is approximately 32 fold of the estimated maximal expected allele frequency for a pathogenic variant in MYBPC3 causing Hypertrophic Cardiomyopathy phenotype (0.001), strongly suggesting that the variant is a benign polymorphism found primarily in populations of South Asian origin. c.3628-41_3628-17del25 has been reported in the literature predominantly in studies of South Asian individuals affected with Hypertrophic Cardiomyopathy (example, Waldmuller_2003, Tanjore_2008, Dhandapany_2009, Alfares_2015, Harper_2020). In a conservative ascertainment of families reported with this variant, we captured 7 transmissions of the variant allele and 5 transmissions of the reference allele to affected individuals (Waldmuller_2003, Tanjore_2008) suggestive of lack of segregation with disease. A recent study reported that the risk of HCM previously attributed to this 25-base pair deletion is explained by a linkage disequilibrium between this deletion and another deep intronic MYBPC3 variant, c.1224-52G>A which is causative of HCM (Harper_2020). Direct comparison of the proportion of heterozygous MYBPC3 delta25 variant carriers between the HCMR (17/134) and gnomAD (943/15 296) South Asian cohorts indicated a 2-fold enrichment within HCM cases (odds ratio [OR], 2.1 [95% CI, 1.2-3.4]; P=0.008). When HCMR probands with the MYBPC3 delta25/52 haplotype were excluded, no difference was observed (OR, 0.96 [95% CI, 0.40-1.95]; P=1.0). Therefore, these data do not allow any conclusion about the significance of c.3628-41_3628-17del25 in isolation. Multiple co-occurrences with other pathogenic variant(s) have been reported, example, PRKAG2 c.905G>A, p.Arg302Gln (Alfares_2015); MYBPC3 c.1224-52G>A; MYBPC3 c.2827C>T, p.Arg943*; MYBPC3 c.821+2T>C (Harper_2020), providing additional supporting evidence for a benign role. At least one publication reports experimental evidence evaluating an impact on protein function in a mice model. The most pronounced variant effect results in an HCM phenotype in mice at 12 weeks of age and mislocalization of the mutant protein to the sarcomere resulting in its categorization as an at-risk allele for heart failure and adverse cardiovascular outcomes (Kuster_2019, Sadayappan_2020). However, in the context of our ascertainment, when objectively ascertained for the degree of reported contractile dysfunction and HCM in vivo attributed to this variant, the evidence as reported is not translatable to an in-vivo impact in humans (Kuster_2019). Eight clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. Multiple laboratories reported the variant with conflicting assessments (pathogenic, n=1; likely pathogenic, n=4, VUS, n=2; benign, n=1). Some submitters cite overlapping but not all the recently published evidence utilized in the context of this ev -

Left ventricular noncompaction 10 Pathogenic:1

Jun 22, 2017

Bioinformatics dept., Datar Cancer Genetics Limited, India

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Cardiovascular phenotype Pathogenic:1

Aug 11, 2023

Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hypertrophic cardiomyopathy 4;C3715165:Left ventricular noncompaction 10 Uncertain:1

May 09, 2023

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: research

- -

Hypertrophic cardiomyopathy Benign:1

Jan 22, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

MYBPC3-related disorder Benign:1

Apr 07, 2020

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=100/0	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs36212066; hg19: chr11-47353825;