rs36212066
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1BS2
The NM_000256.3(MYBPC3):c.3628-41_3628-17delAGCCTGGATGGCTTCCCTCCCTCTC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00185 in 1,613,290 control chromosomes in the GnomAD database, including 67 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). The gene MYBPC3 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000256.3 intron
Scores
Clinical Significance
Conservation
Publications
- hypertrophic cardiomyopathyInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- hypertrophic cardiomyopathy 4Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- left ventricular noncompaction 10Inheritance: AD, AR Classification: DEFINITIVE, MODERATE, LIMITED Submitted by: Ambry Genetics
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- arrhythmogenic right ventricular cardiomyopathyInheritance: AD Classification: LIMITED Submitted by: ClinGen
- atrial fibrillationInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- congenital heart diseaseInheritance: AD Classification: LIMITED Submitted by: ClinGen
- dilated cardiomyopathyInheritance: AR, AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000256.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
Frequencies
GnomAD3 genomes AF: 0.00116 AC: 177AN: 152208Hom.: 3 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.00401 AC: 997AN: 248518 AF XY: 0.00549 show subpopulations
GnomAD4 exome AF: 0.00193 AC: 2813AN: 1460964Hom.: 64 AF XY: 0.00282 AC XY: 2051AN XY: 726800 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00118 AC: 179AN: 152326Hom.: 3 Cov.: 33 AF XY: 0.00188 AC XY: 140AN XY: 74492 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.