rs367543069
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_152490.5(B3GALNT2):c.51_73dupGCACCTCTGGCTGCGGCTGCGCT(p.Ser25CysfsTer38) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. S25S) has been classified as Likely benign.
Frequency
Consequence
NM_152490.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 11Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics, Genomics England PanelApp
- autosomal recessive non-syndromic intellectual disabilityInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- muscle-eye-brain diseaseInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- muscular dystrophy-dystroglycanopathy, type AInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- intellectual disabilityInheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| B3GALNT2 | NM_152490.5 | c.51_73dupGCACCTCTGGCTGCGGCTGCGCT | p.Ser25CysfsTer38 | frameshift_variant | Exon 1 of 12 | ENST00000366600.8 | NP_689703.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| B3GALNT2 | ENST00000366600.8 | c.51_73dupGCACCTCTGGCTGCGGCTGCGCT | p.Ser25CysfsTer38 | frameshift_variant | Exon 1 of 12 | 1 | NM_152490.5 | ENSP00000355559.3 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 11 Pathogenic:1
- -
not provided Other:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at