rs367543069

Variant names:

• chr1-235504179-G-GAGCGCAGCCGCAGCCAGAGGTGC
• rs367543069
• NM_152490.5:c.51_73dupGCACCTCTGGCTGCGGCTGCGCT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_152490.5(B3GALNT2):​c.51_73dupGCACCTCTGGCTGCGGCTGCGCT​(p.Ser25CysfsTer38) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. S25S) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: B3GALNT2 NM_152490.5 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1 O:1
• Conservation: PhyloP100: 2.00
• Publications: 4 publications found

Genes affected

B3GALNT2 (HGNC:28596): (beta-1,3-N-acetylgalactosaminyltransferase 2) This gene encodes a member of the glycosyltransferase 31 family. The encoded protein synthesizes GalNAc:beta-1,3GlcNAc, a novel carbohydrate structure, on N- and O-glycans. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2013]

B3GALNT2 Gene-Disease associations (from GenCC):

• muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 11

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics, G2P
• autosomal recessive non-syndromic intellectual disability

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• muscle-eye-brain disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• muscular dystrophy-dystroglycanopathy, type A

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• intellectual disability

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 39 pathogenic variants in the truncated region.
• PP5: Variant 1-235504179-G-GAGCGCAGCCGCAGCCAGAGGTGC is Pathogenic according to our data. Variant chr1-235504179-G-GAGCGCAGCCGCAGCCAGAGGTGC is described in ClinVar as Pathogenic. ClinVar VariationId is 132979.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_152490.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	B3GALNT2	NM_152490.5	MANE Select	c.51_73dupGCACCTCTGGCTGCGGCTGCGCT	p.Ser25CysfsTer38	frameshift	Exon 1 of 12	NP_689703.1	Q8NCR0-1
	B3GALNT2	NM_001277155.3		c.51_73dupGCACCTCTGGCTGCGGCTGCGCT	p.Ser25CysfsTer58	frameshift	Exon 1 of 8	NP_001264084.1	Q8NCR0-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	B3GALNT2	ENST00000366600.8	TSL:1 MANE Select	c.51_73dupGCACCTCTGGCTGCGGCTGCGCT	p.Ser25CysfsTer38	frameshift	Exon 1 of 12	ENSP00000355559.3	Q8NCR0-1
	B3GALNT2	ENST00000313984.3	TSL:1	c.51_73dupGCACCTCTGGCTGCGGCTGCGCT	p.Ser25CysfsTer58	frameshift	Exon 1 of 8	ENSP00000315678.3	Q8NCR0-2
	B3GALNT2	ENST00000954792.1		c.51_73dupGCACCTCTGGCTGCGGCTGCGCT	p.Ser25CysfsTer58	frameshift	Exon 1 of 13	ENSP00000624851.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 11 (1)
-	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0
Mutation Taster		=15/185	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs367543069;

hg19: chr1-235667479;