rs3831317

Positions:

• chr1-203217822-C-CAGACCATGGCCCCGCCCAGTCCCT

Variant summary

Our verdict is Benign. Variant got -12 ACMG points: 4P and 16B. PM1 PM4 BP6_Very_Strong BA1

The NM_003465.3(CHIT1):​c.1049_1072dupAGGGACTGGGCGGGGCCATGGTCT​(p.Val357_Trp358insTerGlyLeuGlyGlyAlaMetVal) variant causes a stop gained, conservative inframe insertion change. The variant allele was found at a frequency of 0.216 in 1,612,092 control chromosomes in the GnomAD database, including 43,887 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.18 (3446 hom., cov: 30)
  • Exomes 𝑓: 0.22 (40441 hom.)
• Consequence: CHIT1 NM_003465.3 stop_gained, conservative_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:4 O:1
• Conservation: PhyloP100: 6.53

Genes affected

CHIT1 (HGNC:1936): (chitinase 1) Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2012]

CHIT1 (HGNC:):

ACMG classification

Verdict is Benign. Variant got -12 ACMG points.

• PM1: In a binding_site (size 0) in uniprot entity CHIT1_HUMAN
• PM4: Nonframeshift variant in NON repetitive region in NM_003465.3.
• BP6: Variant 1-203217822-C-CAGACCATGGCCCCGCCCAGTCCCT is Benign according to our data. Variant chr1-203217822-C-CAGACCATGGCCCCGCCCAGTCCCT is described in ClinVar as [Likely_benign]. Clinvar id is 294920.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.556 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CHIT1	NM_003465.3	c.1049_1072dupAGGGACTGGGCGGGGCCATGGTCT	p.Val357_Trp358insTerGlyLeuGlyGlyAlaMetVal	stop_gained, conservative_inframe_insertion	10/11	ENST00000367229.6	NP_003456.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CHIT1	ENST00000367229.6	c.1049_1072dupAGGGACTGGGCGGGGCCATGGTCT	p.Val357_Trp358insTerGlyLeuGlyGlyAlaMetVal	stop_gained, conservative_inframe_insertion	10/11	1	NM_003465.3	ENSP00000356198.1

Frequencies

GnomAD3 genomes AF: 0.182 AC: 27698 AN: 151884 Hom.: 3436 Cov.: 30

Gnomad AFR AF: 0.0541

Gnomad AMI AF: 0.132

Gnomad AMR AF: 0.259

Gnomad ASJ AF: 0.208

Gnomad EAS AF: 0.573

Gnomad SAS AF: 0.427

Gnomad FIN AF: 0.179

Gnomad MID AF: 0.231

Gnomad NFE AF: 0.195

Gnomad OTH AF: 0.208

GnomAD4 exome AF: 0.220 AC: 321217 AN: 1460092 Hom.: 40441 Cov.: 34 AF XY: 0.225 AC XY: 163467 AN XY: 726266

Gnomad4 AFR exome AF: 0.0446

Gnomad4 AMR exome AF: 0.273

Gnomad4 ASJ exome AF: 0.217

Gnomad4 EAS exome AF: 0.562

Gnomad4 SAS exome AF: 0.396

Gnomad4 FIN exome AF: 0.180

Gnomad4 NFE exome AF: 0.199

Gnomad4 OTH exome AF: 0.225

GnomAD4 genome AF: 0.182 AC: 27717 AN: 152000 Hom.: 3446 Cov.: 30 AF XY: 0.190 AC XY: 14127 AN XY: 74270

Gnomad4 AFR AF: 0.0539

Gnomad4 AMR AF: 0.261

Gnomad4 ASJ AF: 0.208

Gnomad4 EAS AF: 0.573

Gnomad4 SAS AF: 0.428

Gnomad4 FIN AF: 0.179

Gnomad4 NFE AF: 0.195

Gnomad4 OTH AF: 0.209

Alfa AF: 0.166 Hom.: 305

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:4 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Chitotriosidase deficiency Benign:4 Other:1

Benign, criteria provided, single submitter	clinical testing	Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital	Jan 06, 2020	- -
Affects, no assertion criteria provided	literature only	OMIM	Sep 01, 2007	- -
Likely benign, criteria provided, single submitter	clinical testing	Illumina Laboratory Services, Illumina	Jun 14, 2016	- -
Benign, criteria provided, single submitter	clinical testing	Revvity Omics, Revvity	Nov 04, 2022	- -
Benign, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Dec 30, 2019	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3831317; hg19: chr1-203186950;