rs3842570

Positions:

• chr2-240594824-AGATGATTCTGTCCCAGGAGCCGGGAGGAGGGT-A
• chr2-240594824-AGATGATTCTGTCCCAGGAGCCGGGAGGAGGGT-AGATGATTCTGTCCCAGGAGCCGGGAGGAGGGTGATGATTCTGTCCCAGGAGCCGGGAGGAGGGT
• chr2-240594824-AGATGATTCTGTCCCAGGAGCCGGGAGGAGGGT-AGATGATTCTGTCCCAGGAGCCGGGAGGAGGGTGATGATTCTGTCCCAGGAGCCGGGAGGAGGGTGATGATTCTGTCCCAGGAGCCGGGAGGAGGGT

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_023083.4(CAPN10):​c.997+136_998-148delCGGGAGGAGGGTGATGATTCTGTCCCAGGAGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000909 in 660,420 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0 (0 hom., cov: 37)
  • Exomes 𝑓: 0.0000091 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: CAPN10 NM_023083.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.158

Genes affected

CAPN10 (HGNC:1477): (calpain 10) Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. [provided by RefSeq, Sep 2010]

CAPN10 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CAPN10	NM_023083.4	c.997+136_998-148delCGGGAGGAGGGTGATGATTCTGTCCCAGGAGC		intron_variant		ENST00000391984.7	NP_075571.2
CAPN10	NM_023085.4	c.997+136_998-148delCGGGAGGAGGGTGATGATTCTGTCCCAGGAGC		intron_variant			NP_075573.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CAPN10	ENST00000391984.7	c.997+136_998-148delCGGGAGGAGGGTGATGATTCTGTCCCAGGAGC		intron_variant		1	NM_023083.4	ENSP00000375844.2

Frequencies

GnomAD3 genomes AF: 0.00 AC: 0 AN: 135030 Hom.: 0 Cov.: 37 FAILED QC

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000909 AC: 6 AN: 660420 Hom.: 0 AF XY: 0.0000119 AC XY: 4 AN XY: 337152

Gnomad4 AFR exome AF: 0.000241

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000223

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 135030 Hom.: 0 Cov.: 37 AF XY: 0.00 AC XY: 0 AN XY: 64926

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

Alfa AF: 0.0000660 Hom.: 878

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3842570; hg19: chr2-241534241;