rs386833741

Variant names:

• chr16-28482308-CTGCCCTCGCTCCTCTTACCAGCGGTAT-C
• rs386833741
• NM_001042432.2:c.954_962+18delATACCGCTGGTAAGAGGAGCGAGGGCA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1_Moderate PP5_Very_Strong

The NM_000086.2(CLN3):​c.954_962+18delATACCGCTGGTAAGAGGAGCGAGGGCA​(p.Tyr319_Trp321del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000093 in 1,612,710 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0000082 (0 hom.)
• Consequence: CLN3 NM_000086.2 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:7
• Conservation: PhyloP100: 0.683
• Publications: 2 publications found

Genes affected

CLN3 (HGNC:2074): (CLN3 lysosomal/endosomal transmembrane protein, battenin) This gene encodes a protein that is involved in lysosomal function. Mutations in this, as well as other neuronal ceroid-lipofuscinosis (CLN) genes, cause neurodegenerative diseases commonly known as Batten disease or collectively known as neuronal ceroid lipofuscinoses (NCLs). Many alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]

CLN3 Gene-Disease associations (from GenCC):

• inherited retinal dystrophy

  Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
• neuronal ceroid lipofuscinosis

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• neuronal ceroid lipofuscinosis 3

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Myriad Women’s Health

ENSG00000261832 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.04252088 fraction of the gene. Cryptic splice site detected, with MaxEntScore 3.5, offset of -42, new splice context is: ctgGTattt. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
• PP5: Variant 16-28482308-CTGCCCTCGCTCCTCTTACCAGCGGTAT-C is Pathogenic according to our data. Variant chr16-28482308-CTGCCCTCGCTCCTCTTACCAGCGGTAT-C is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 56293.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000086.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CLN3	NM_001042432.2	MANE Select	c.954_962+18delATACCGCTGGTAAGAGGAGCGAGGGCA	p.Tyr319_Trp321del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 13 of 16	NP_001035897.1
	CLN3	NM_000086.2		c.954_962+18delATACCGCTGGTAAGAGGAGCGAGGGCA	p.Tyr319_Trp321del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 12 of 15	NP_000077.1
	CLN3	NM_001286104.2		c.882_890+18delATACCGCTGGTAAGAGGAGCGAGGGCA	p.Tyr295_Trp297del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 12 of 15	NP_001273033.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CLN3	ENST00000636147.2	TSL:1 MANE Select	c.954_962+18delATACCGCTGGTAAGAGGAGCGAGGGCA	p.Tyr319_Trp321del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 13 of 16	ENSP00000490105.1
	CLN3	ENST00000359984.12	TSL:1	c.954_962+18delATACCGCTGGTAAGAGGAGCGAGGGCA	p.Tyr319_Trp321del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 12 of 15	ENSP00000353073.9
	CLN3	ENST00000565316.6	TSL:1	c.903_911+18delATACCGCTGGTAAGAGGAGCGAGGGCA	p.Tyr302_Trp304del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 11 of 14	ENSP00000456117.1

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152200 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000804 AC: 2 AN: 248612 AF XY: 0.0000149

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000178

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000822 AC: 12 AN: 1460510 Hom.: 0 AF XY: 0.00000826 AC XY: 6 AN XY: 726424

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33470

American (AMR) AF: 0.00 AC: 0 AN: 44550

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26096

East Asian (EAS) AF: 0.00 AC: 0 AN: 39678

South Asian (SAS) AF: 0.00 AC: 0 AN: 86044

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53030

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000108 AC: 12 AN: 1111514

Other (OTH) AF: 0.00 AC: 0 AN: 60360

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 152200 Hom.: 0 Cov.: 31 AF XY: 0.0000134 AC XY: 1 AN XY: 74360

African (AFR) AF: 0.00 AC: 0 AN: 41462

American (AMR) AF: 0.00 AC: 0 AN: 15270

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5186

South Asian (SAS) AF: 0.00 AC: 0 AN: 4836

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10622

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000441 AC: 3 AN: 68032

Other (OTH) AF: 0.00 AC: 0 AN: 2092

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000756

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	Neuronal ceroid lipofuscinosis 3 (3)
2	-	-	Neuronal ceroid lipofuscinosis (2)
1	-	-	Inborn genetic diseases (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.68
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs386833741; hg19: chr16-28493629;