rs386833741

Variant names:

• chr16-28482308-CTGCCCTCGCTCCTCTTACCAGCGGTAT-C
• rs386833741
• ENST00000566057.5:n.*250_*258+18delATACCGCTGGTAAGAGGAGCGAGGGCA

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PP5_Very_Strong

The ENST00000566057.5(CLN3):​n.*250_*258+18delATACCGCTGGTAAGAGGAGCGAGGGCA variant causes a splice region, non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000093 in 1,612,710 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0000082 (0 hom.)
• Consequence: CLN3 ENST00000566057.5 splice_region, non_coding_transcript_exon
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:7
• Conservation: PhyloP100: 0.683
• Publications: 2 publications found

Genes affected

CLN3 (HGNC:2074): (CLN3 lysosomal/endosomal transmembrane protein, battenin) This gene encodes a protein that is involved in lysosomal function. Mutations in this, as well as other neuronal ceroid-lipofuscinosis (CLN) genes, cause neurodegenerative diseases commonly known as Batten disease or collectively known as neuronal ceroid lipofuscinoses (NCLs). Many alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]

CLN3 Gene-Disease associations (from GenCC):

• inherited retinal dystrophy

  Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
• neuronal ceroid lipofuscinosis

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• neuronal ceroid lipofuscinosis 3

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Myriad Women’s Health

ENSG00000261832 (HGNC:):

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PP5: Variant 16-28482308-CTGCCCTCGCTCCTCTTACCAGCGGTAT-C is Pathogenic according to our data. Variant chr16-28482308-CTGCCCTCGCTCCTCTTACCAGCGGTAT-C is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 56293.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CLN3	NM_001042432.2	c.954_962+18delATACCGCTGGTAAGAGGAGCGAGGGCA	p.Tyr319_Trp321del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 13 of 16	ENST00000636147.2	NP_001035897.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CLN3	ENST00000636147.2	c.954_962+18delATACCGCTGGTAAGAGGAGCGAGGGCA	p.Tyr319_Trp321del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 13 of 16	1	NM_001042432.2	ENSP00000490105.1
ENSG00000261832	ENST00000637378.1	c.126_134+18delATACCGCTGGTAAGAGGAGCGAGGGCA	p.Tyr43_Trp45del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 3 of 10	5		ENSP00000490831.1

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152200 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000804 AC: 2 AN: 248612 AF XY: 0.0000149

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000178

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000822 AC: 12 AN: 1460510 Hom.: 0 AF XY: 0.00000826 AC XY: 6 AN XY: 726424

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33470

American (AMR) AF: 0.00 AC: 0 AN: 44550

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26096

East Asian (EAS) AF: 0.00 AC: 0 AN: 39678

South Asian (SAS) AF: 0.00 AC: 0 AN: 86044

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53030

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000108 AC: 12 AN: 1111514

Other (OTH) AF: 0.00 AC: 0 AN: 60360

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 152200 Hom.: 0 Cov.: 31 AF XY: 0.0000134 AC XY: 1 AN XY: 74360

African (AFR) AF: 0.00 AC: 0 AN: 41462

American (AMR) AF: 0.00 AC: 0 AN: 15270

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5186

South Asian (SAS) AF: 0.00 AC: 0 AN: 4836

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10622

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000441 AC: 3 AN: 68032

Other (OTH) AF: 0.00 AC: 0 AN: 2092

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000756

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:7

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Neuronal ceroid lipofuscinosis 3 Pathogenic:3

-

Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM)

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Nov 07, 2023

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 31, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Neuronal ceroid lipofuscinosis Pathogenic:2

Dec 17, 2021

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: CLN3 c.954_962+18del27 is located in a canonical splice-site and is predicted to affect mRNA splicing resulting in a significantly altered protein due to either exon skipping, shortening, or inclusion of intronic material. Several computational tools predict a significant impact on normal splicing: Four predict the variant abolishes a canonical 5' splicing donor site. However, these predictions have yet to be confirmed by functional studies. The variant allele was found at a frequency of 8e-06 in 248612 control chromosomes (gnomAD). c.954_962+18del27 has been reported in the literature in individuals affected with Juvenile Neuronal Ceroid-Lipofuscinosis (Juvenile Batten Disease) (examples: Kwon_2011 and Pronicka_2016). These data indicate that the variant may be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. One clinical diagnostic laboratory has submitted clinical-significance assessments for this variant to ClinVar after 2014 and classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic. -

Jan 21, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 13 (c.954_962+18del) of the CLN3 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in CLN3 are known to be pathogenic (PMID: 9311735, 28542676). This variant is present in population databases (rs386833741, gnomAD 0.002%). This variant has been observed in individuals with CLN3-related conditions (PMID: 21990111). ClinVar contains an entry for this variant (Variation ID: 56293). For these reasons, this variant has been classified as Pathogenic. -

Inborn genetic diseases Pathogenic:1

Feb 12, 2020

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.954_962+18del27 pathogenic mutation results from a deletion of 27 nucleotides spanning across the splice donor site after coding exon 12 in the CLN3 gene. This mutation was detected in an individual with a diagnosis of Batten disease who had another pathogenic mutation on the other chromosome. In addition, this mutation was detected in three individuals with neuronal ceroid lipofuscinosis, two of whom had a second pathogenic mutation (the phase is unknown) (Kousi M et al. Hum. Mutat., 2012 Jan;33:42-63). Using the BDGP and ESEfinder splice site prediction tools, this alteration is predicted to abolish the native splice donor site; however, direct evidence is unavailable. Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as a disease-causing mutation. -

not provided Pathogenic:1

Mar 01, 2024

CeGaT Center for Human Genetics Tuebingen

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

CLN3: PVS1, PM2, PM3 -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.68
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs386833741; hg19: chr16-28493629;