rs386833891

Variant names:

• chr19-35845512-TCCGGGGTGGGGCGGCCACGCCCTCCAGCCTGTGGAA-T
• rs386833891
• NM_004646.4:c.1758-8_1785delTTCCACAGGCTGGAGGGCGTGGCCGCCCCACCCCGG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_004646.4(NPHS1):​c.1758-8_1785delTTCCACAGGCTGGAGGGCGTGGCCGCCCCACCCCGG​(p.Leu587fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000274 in 1,458,296 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000027 (0 hom.)
• Consequence: NPHS1 NM_004646.4 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 2.10
• Publications: 1 publications found

Genes affected

NPHS1 (HGNC:7908): (NPHS1 adhesion molecule, nephrin) This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]

NPHS1 Gene-Disease associations (from GenCC):

• congenital nephrotic syndrome, Finnish type

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Myriad Women’s Health, ClinGen, Orphanet
• familial idiopathic steroid-resistant nephrotic syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 19-35845512-TCCGGGGTGGGGCGGCCACGCCCTCCAGCCTGTGGAA-T is Pathogenic according to our data. Variant chr19-35845512-TCCGGGGTGGGGCGGCCACGCCCTCCAGCCTGTGGAA-T is described in ClinVar as Pathogenic. ClinVar VariationId is 56449.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004646.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NPHS1	NM_004646.4	MANE Select	c.1758-8_1785delTTCCACAGGCTGGAGGGCGTGGCCGCCCCACCCCGG	p.Leu587fs	frameshift splice_acceptor splice_region intron	Exon 14 of 29	NP_004637.1	O60500-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NPHS1	ENST00000378910.10	TSL:1 MANE Select	c.1758-8_1785delTTCCACAGGCTGGAGGGCGTGGCCGCCCCACCCCGG	p.Leu587fs	frameshift splice_acceptor splice_region intron	Exon 14 of 29	ENSP00000368190.4	O60500-1
	NPHS1	ENST00000869106.1		c.1698-8_1725delTTCCACAGGCTGGAGGGCGTGGCCGCCCCACCCCGG	p.Leu567fs	frameshift splice_acceptor splice_region intron	Exon 14 of 29	ENSP00000539165.1
	NPHS1	ENST00000353632.6	TSL:5	c.1758-8_1785delTTCCACAGGCTGGAGGGCGTGGCCGCCCCACCCCGG	p.Leu587fs	frameshift splice_acceptor splice_region intron	Exon 14 of 28	ENSP00000343634.5	O60500-2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000425 AC: 1 AN: 235108 AF XY: 0.00000775

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000274 AC: 4 AN: 1458296 Hom.: 0 AF XY: 0.00000551 AC XY: 4 AN XY: 725320

African (AFR) AF: 0.00 AC: 0 AN: 33422

American (AMR) AF: 0.00 AC: 0 AN: 44390

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26020

East Asian (EAS) AF: 0.00 AC: 0 AN: 39598

South Asian (SAS) AF: 0.0000465 AC: 4 AN: 85944

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52440

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5448

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1110880

Other (OTH) AF: 0.00 AC: 0 AN: 60154

GnomAD4 genome Cov.: 32

Asia WGS AF: 0.000577 AC: 2 AN: 3478

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	Finnish congenital nephrotic syndrome (3)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs386833891; hg19: chr19-36336414;