rs386834175

Variant names:

• chr14-102929454-GCTCCAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCC-G
• rs386834175
• NM_030943.4:c.683_730delAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCCCTCC

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP5

The NM_030943.4(AMN):​c.683_730delAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCCCTCC​(p.Gln228_Leu243del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000657 in 152,196 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. Q228Q) has been classified as Likely benign.

• Frequency: Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
• Consequence: AMN NM_030943.4 disruptive_inframe_deletion
• Clinical Significance: Likely pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 3.84
• Publications: 2 publications found

Genes affected

AMN (HGNC:14604): (amnion associated transmembrane protein) The protein encoded by this gene is a type I transmembrane protein. It is thought to modulate bone morphogenetic protein (BMP) receptor function by serving as an accessory or coreceptor, and thus facilitates or hinders BMP binding. It is known that the mouse AMN gene is expressed in the extraembryonic visceral endoderm layer during gastrulation, but it is found to be mutated in amnionless mouse. The encoded protein has sequence similarity to short gastrulation (Sog) and procollagen IIA proteins in Drosophila. [provided by RefSeq, Jul 2008]

AMN Gene-Disease associations (from GenCC):

• Imerslund-Grasbeck syndrome type 1

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• Imerslund-Grasbeck syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_030943.4.
• PP5: Variant 14-102929454-GCTCCAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCC-G is Pathogenic according to our data. Variant chr14-102929454-GCTCCAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCC-G is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 56757.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AMN	NM_030943.4	c.683_730delAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCCCTCC	p.Gln228_Leu243del	disruptive_inframe_deletion	Exon 7 of 12	ENST00000299155.10	NP_112205.2
AMN	NM_001425246.1	c.521_568delAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCCCTCC	p.Gln174_Leu189del	disruptive_inframe_deletion	Exon 7 of 12		NP_001412175.1
AMN	XM_011537203.4	c.521_568delAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCCCTCC	p.Gln174_Leu189del	disruptive_inframe_deletion	Exon 7 of 12		XP_011535505.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AMN	ENST00000299155.10	c.683_730delAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCCCTCC	p.Gln228_Leu243del	disruptive_inframe_deletion	Exon 7 of 12	1	NM_030943.4	ENSP00000299155.6

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152196 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152196 Hom.: 0 Cov.: 33 AF XY: 0.0000135 AC XY: 1 AN XY: 74348

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41462

American (AMR) AF: 0.00 AC: 0 AN: 15288

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5188

South Asian (SAS) AF: 0.00 AC: 0 AN: 4838

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10630

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68006

Other (OTH) AF: 0.00 AC: 0 AN: 2094

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Imerslund-Grasbeck syndrome Pathogenic:1

-

Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM)

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.8
Mutation Taster		=15/185	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs386834175; hg19: chr14-103395791;