rs387906428

Variant names:

• chrX-134500062-AAAATACAAAGCCTAAGATGAG-A
• rs387906428
• NM_000194.3:c.644_*7delAATACAAAGCCTAAGATGAGA

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP5

The NM_000194.3(HPRT1):​c.644_*7delAATACAAAGCCTAAGATGAGA​(p.Lys215_Ter219delins???) variant causes a stop lost, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic,other (no stars).

• Frequency: Genomes: not found (cov: 23)
• Consequence: HPRT1 NM_000194.3 stop_lost, conservative_inframe_deletion
• Clinical Significance: Pathogenic; other no assertion criteria provided P:1 O:1
• Conservation: PhyloP100: 8.52
• Publications: 1 publications found

Genes affected

HPRT1 (HGNC:5157): (hypoxanthine phosphoribosyltransferase 1) The protein encoded by this gene is a transferase, which catalyzes conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate via transfer of the 5-phosphoribosyl group from 5-phosphoribosyl 1-pyrophosphate. This enzyme plays a central role in the generation of purine nucleotides through the purine salvage pathway. Mutations in this gene result in Lesch-Nyhan syndrome or gout.[provided by RefSeq, Jun 2009]

HPRT1 Gene-Disease associations (from GenCC):

• Lesch-Nyhan syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), Orphanet, G2P, Ambry Genetics
• hypoxanthine guanine phosphoribosyltransferase partial deficiency

  Inheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a chain Hypoxanthine-guanine phosphoribosyltransferase (size 216) in uniprot entity HPRT_HUMAN there are 49 pathogenic changes around while only 1 benign (98%) in NM_000194.3
• PM4: Stoplost variant in NM_000194.3 Downstream stopcodon found after 267 codons.
• PP5: Variant X-134500062-AAAATACAAAGCCTAAGATGAG-A is Pathogenic according to our data. Variant chrX-134500062-AAAATACAAAGCCTAAGATGAG-A is described in ClinVar as Pathogenic|other. ClinVar VariationId is 10035.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HPRT1	NM_000194.3	c.644_*7delAATACAAAGCCTAAGATGAGA	p.Lys215_Ter219delins???	stop_lost, conservative_inframe_deletion	Exon 9 of 9	ENST00000298556.8	NP_000185.1
HPRT1	NM_000194.3	c.644_*7delAATACAAAGCCTAAGATGAGA		3_prime_UTR_variant	Exon 9 of 9	ENST00000298556.8	NP_000185.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HPRT1	ENST00000298556.8	c.644_*7delAATACAAAGCCTAAGATGAGA	p.Lys215_Ter219delins???	stop_lost, conservative_inframe_deletion	Exon 9 of 9	1	NM_000194.3	ENSP00000298556.7
HPRT1	ENST00000298556.8	c.644_*7delAATACAAAGCCTAAGATGAGA		3_prime_UTR_variant	Exon 9 of 9	1	NM_000194.3	ENSP00000298556.7
HPRT1	ENST00000475720.1	n.567+1380_567+1400delAATACAAAGCCTAAGATGAGA		intron_variant	Intron 7 of 7	3

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

Significance: Pathogenic; other

Submissions summary: Pathogenic:1 Other:1

Revision: no assertion criteria provided

Submissions by phenotype

Lesch-Nyhan syndrome Pathogenic:1

Jun 01, 1990

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

HPRT EVANSVILLE Other:1

Sep 26, 2017

OMIM

Significance: other

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.5
Mutation Taster		=18/182	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs387906428; hg19: chrX-133634092;