rs387906542

Variant names:

• chr7-27199671-G-GAGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC
• rs387906542
• NM_000522.5:c.355_406dupGCTGCTGCCGCGGCTGCCGCTGCAGCCGCCGCCGCCGCCGCCGCGTCGTCCT

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_000522.5(HOXA13):​c.355_406dupGCTGCTGCCGCGGCTGCCGCTGCAGCCGCCGCCGCCGCCGCCGCGTCGTCCT​(p.Ser136CysfsTer108) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: HOXA13 NM_000522.5 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.50
• Publications: 1 publications found

Genes affected

HOXA13 (HGNC:5102): (homeobox A13) In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Expansion of a polyalanine tract in the encoded protein can cause hand-foot-uterus syndrome, also known as hand-foot-genital syndrome. [provided by RefSeq, Jul 2008]

HOTTIP (HGNC:37461): (HOXA distal transcript antisense RNA) This gene produces a long RNA in antisense to the HOXA gene cluster. This transcript may regulate expression of HOXA genes in cis. This gene is upregulated in tumors and is implicated in the promotion of cell proliferation. [provided by RefSeq, Dec 2017]

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 7-27199671-G-GAGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC is Pathogenic according to our data. Variant chr7-27199671-G-GAGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC is described in ClinVar as Pathogenic. ClinVar VariationId is 14896.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000522.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HOXA13	NM_000522.5	MANE Select	c.355_406dupGCTGCTGCCGCGGCTGCCGCTGCAGCCGCCGCCGCCGCCGCCGCGTCGTCCT	p.Ser136CysfsTer108	frameshift	Exon 1 of 2	NP_000513.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HOXA13	ENST00000649031.1	MANE Select	c.355_406dupGCTGCTGCCGCGGCTGCCGCTGCAGCCGCCGCCGCCGCCGCCGCGTCGTCCT	p.Ser136CysfsTer108	frameshift	Exon 1 of 2	ENSP00000497112.1
	HOTTIP	ENST00000421733.1	TSL:5	n.167+931_168-900dupAGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC		intron	N/A
	HOTTIP	ENST00000605136.7	TSL:2	n.92+342_92+393dupAGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Hand-foot-genital syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.5
Mutation Taster		=21/179	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs387906542; hg19: chr7-27239290;