rs397508136

Variant names:

• chr7-117480081-GCGCCCGAGAGACCATGCAGAGGT-G
• rs397508136
• NM_000492.4:c.-9_14delCGAGAGACCATGCAGAGGTCGCC

Variant summary

Our verdict is Pathogenic. The variant received 18 ACMG points: 18P and 0B. PVS1 PS1_Moderate PP5_Very_Strong

The NM_000492.4(CFTR):​c.-9_14delCGAGAGACCATGCAGAGGTCGCC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000186 in 1,613,774 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: CFTR NM_000492.4 frameshift, start_lost
• Clinical Significance: Pathogenic reviewed by expert panel P:6
• Conservation: PhyloP100: 3.24
• Publications: 3 publications found

Genes affected

CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]

CFTR Gene-Disease associations (from GenCC):

• cystic fibrosis

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Laboratory for Molecular Medicine
• congenital bilateral absence of vas deferens

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary chronic pancreatitis

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 18 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 1270 pathogenic variants in the truncated region.
• PS1: Another start lost variant in NM_000492.4 (CFTR) was described as [Pathogenic] in ClinVar
• PP5: Variant 7-117480081-GCGCCCGAGAGACCATGCAGAGGT-G is Pathogenic according to our data. Variant chr7-117480081-GCGCCCGAGAGACCATGCAGAGGT-G is described in ClinVar as Pathogenic. ClinVar VariationId is 53158.Status of the report is reviewed_by_expert_panel, 3 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000492.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CFTR	NM_000492.4	MANE Select	c.-9_14delCGAGAGACCATGCAGAGGTCGCC	p.Met1fs	frameshift start_lost	Exon 1 of 27	NP_000483.3
	CFTR	NM_000492.4	MANE Select	c.-9_14delCGAGAGACCATGCAGAGGTCGCC		5_prime_UTR	Exon 1 of 27	NP_000483.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CFTR	ENST00000003084.11	TSL:1 MANE Select	c.-9_14delCGAGAGACCATGCAGAGGTCGCC	p.Met1fs	frameshift start_lost	Exon 1 of 27	ENSP00000003084.6	P13569-1
	CFTR	ENST00000003084.11	TSL:1 MANE Select	c.-9_14delCGAGAGACCATGCAGAGGTCGCC		5_prime_UTR	Exon 1 of 27	ENSP00000003084.6	P13569-1
	CFTR	ENST00000546407.1	TSL:1	n.166+4278_166+4300delCGAGAGACCATGCAGAGGTCGCC		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.00000658 AC: 1 AN: 152058 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1461716 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727168

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33474

American (AMR) AF: 0.00 AC: 0 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26134

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86248

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53372

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5762

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1111928

Other (OTH) AF: 0.00 AC: 0 AN: 60380

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000658 AC: 1 AN: 152058 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74264

African (AFR) AF: 0.00 AC: 0 AN: 41392

American (AMR) AF: 0.00 AC: 0 AN: 15274

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5166

South Asian (SAS) AF: 0.00 AC: 0 AN: 4824

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10604

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68010

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
5	-	-	Cystic fibrosis (5)
1	-	-	CFTR-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.2
Mutation Taster		=5/195	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397508136; hg19: chr7-117120135;