rs397509374

Variant names:

• chr2-189002994-GCTCCGGGTGAGAAAGGTGAAGGAGGCC-G
• rs397509374
• NM_000090.4:c.2490_2516delGGGTGAGAAAGGTGAAGGAGGCCCTCC

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_000090.4(COL3A1):​c.2490_2516delGGGTGAGAAAGGTGAAGGAGGCCCTCC​(p.Gly831_Pro839del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. P830P) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: COL3A1 NM_000090.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.74
• Publications: 1 publications found

Genes affected

COL3A1 (HGNC:2201): (collagen type III alpha 1 chain) This gene encodes the pro-alpha1 chains of type III collagen, a fibrillar collagen that is found in extensible connective tissues such as skin, lung, uterus, intestine and the vascular system, frequently in association with type I collagen. Mutations in this gene are associated with Ehlers-Danlos syndrome type IV, and with aortic and arterial aneurysms. [provided by R. Dalgleish, Feb 2008]

COL3A1 Gene-Disease associations (from GenCC):

• autosomal dominant Ehlers-Danlos syndrome, vascular type

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
• Ehlers-Danlos syndrome, vascular type

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• polymicrogyria with or without vascular-type Ehlers-Danlos syndrome

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 10 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 10 uncertain in NM_000090.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000090.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 2-189002994-GCTCCGGGTGAGAAAGGTGAAGGAGGCC-G is Pathogenic according to our data. Variant chr2-189002994-GCTCCGGGTGAGAAAGGTGAAGGAGGCC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 17214.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000090.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL3A1	NM_000090.4	MANE Select	c.2490_2516delGGGTGAGAAAGGTGAAGGAGGCCCTCC	p.Gly831_Pro839del	disruptive_inframe_deletion	Exon 36 of 51	NP_000081.2	P02461-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL3A1	ENST00000304636.9	TSL:1 MANE Select	c.2490_2516delGGGTGAGAAAGGTGAAGGAGGCCCTCC	p.Gly831_Pro839del	disruptive_inframe_deletion	Exon 36 of 51	ENSP00000304408.4	P02461-1
	COL3A1	ENST00000450867.2	TSL:1	c.2391_2417delGGGTGAGAAAGGTGAAGGAGGCCCTCC	p.Gly798_Pro806del	disruptive_inframe_deletion	Exon 35 of 50	ENSP00000415346.2	H7C435
	COL3A1	ENST00000879201.1		c.2481_2507delGGGTGAGAAAGGTGAAGGAGGCCCTCC	p.Gly828_Pro836del	disruptive_inframe_deletion	Exon 36 of 51	ENSP00000549260.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Ehlers-Danlos syndrome, type 4 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.7
Mutation Taster		=5/195	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397509374; hg19: chr2-189867720;