rs397509374

Variant names:

• chr2-189002994-GCTCCGGGTGAGAAAGGTGAAGGAGGCC-G
• rs397509374
• NM_000090.4:c.2490_2516delGGGTGAGAAAGGTGAAGGAGGCCCTCC

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PM1 PM2 PM4 PP3 PP5

The NM_000090.4(COL3A1):​c.2490_2516delGGGTGAGAAAGGTGAAGGAGGCCCTCC​(p.Gly831_Pro839del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. P830P) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: COL3A1 NM_000090.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.74

Genes affected

COL3A1 (HGNC:2201): (collagen type III alpha 1 chain) This gene encodes the pro-alpha1 chains of type III collagen, a fibrillar collagen that is found in extensible connective tissues such as skin, lung, uterus, intestine and the vascular system, frequently in association with type I collagen. Mutations in this gene are associated with Ehlers-Danlos syndrome type IV, and with aortic and arterial aneurysms. [provided by R. Dalgleish, Feb 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PM1: In a modified_residue 4-hydroxyproline (size 0) in uniprot entity CO3A1_HUMAN
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000090.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 2-189002994-GCTCCGGGTGAGAAAGGTGAAGGAGGCC-G is Pathogenic according to our data. Variant chr2-189002994-GCTCCGGGTGAGAAAGGTGAAGGAGGCC-G is described in ClinVar as [Pathogenic]. Clinvar id is 17214.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
COL3A1	NM_000090.4	c.2490_2516delGGGTGAGAAAGGTGAAGGAGGCCCTCC	p.Gly831_Pro839del	disruptive_inframe_deletion	Exon 36 of 51	ENST00000304636.9	NP_000081.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
COL3A1	ENST00000304636.9	c.2490_2516delGGGTGAGAAAGGTGAAGGAGGCCCTCC	p.Gly831_Pro839del	disruptive_inframe_deletion	Exon 36 of 51	1	NM_000090.4	ENSP00000304408.4
COL3A1	ENST00000450867.2	c.2391_2417delGGGTGAGAAAGGTGAAGGAGGCCCTCC	p.Gly798_Pro806del	disruptive_inframe_deletion	Exon 35 of 50	1		ENSP00000415346.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Ehlers-Danlos syndrome, type 4 Pathogenic:1

Jan 01, 1992

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397509374; hg19: chr2-189867720;