rs397514545

Variant names:

• chr12-63808823-GACGTGATGACAGCTGGCAACTGTGGGAA-G
• rs397514545
• NM_014254.3:c.1064_1091delACGTGATGACAGCTGGCAACTGTGGGAA

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1_Strong PP5_Very_Strong

The NM_014254.3(RXYLT1):​c.1064_1091delACGTGATGACAGCTGGCAACTGTGGGAA​(p.Asp355ValfsTer33) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000547 in 1,461,824 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. D355D) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000055 (0 hom.)
• Consequence: RXYLT1 NM_014254.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 9.09
• Publications: 1 publications found

Genes affected

RXYLT1 (HGNC:13530): (ribitol xylosyltransferase 1) This gene encodes a type II transmembrane protein that is thought to have glycosyltransferase function. Mutations in this gene result in cobblestone lissencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]

RXYLT1-AS1 (HGNC:48910): (RXYLT1 antisense RNA 1)

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.201 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
• PP5: Variant 12-63808823-GACGTGATGACAGCTGGCAACTGTGGGAA-G is Pathogenic according to our data. Variant chr12-63808823-GACGTGATGACAGCTGGCAACTGTGGGAA-G is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 39606.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_014254.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RXYLT1	NM_014254.3	MANE Select	c.1064_1091delACGTGATGACAGCTGGCAACTGTGGGAA	p.Asp355ValfsTer33	frameshift	Exon 6 of 6	NP_055069.1	Q9Y2B1
	RXYLT1	NM_001278237.2		c.284_311delACGTGATGACAGCTGGCAACTGTGGGAA	p.Asp95ValfsTer33	frameshift	Exon 6 of 6	NP_001265166.1
	RXYLT1-AS1	NR_126167.1		n.557_*21delTTCCCACAGTTGCCAGCTGTCATCACGT		splice_region non_coding_transcript_exon	Exon 4 of 4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RXYLT1	ENST00000261234.11	TSL:1 MANE Select	c.1064_1091delACGTGATGACAGCTGGCAACTGTGGGAA	p.Asp355ValfsTer33	frameshift	Exon 6 of 6	ENSP00000261234.6	Q9Y2B1
	RXYLT1	ENST00000537373.6	TSL:1	n.*799_*826delACGTGATGACAGCTGGCAACTGTGGGAA		non_coding_transcript_exon	Exon 6 of 6	ENSP00000440280.2	G3V1K2
	RXYLT1	ENST00000537373.6	TSL:1	n.*799_*826delACGTGATGACAGCTGGCAACTGTGGGAA		3_prime_UTR	Exon 6 of 6	ENSP00000440280.2	G3V1K2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000796 AC: 2 AN: 251290 AF XY: 0.00000736

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000176

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000547 AC: 8 AN: 1461824 Hom.: 0 AF XY: 0.00000413 AC XY: 3 AN XY: 727206

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33476

American (AMR) AF: 0.00 AC: 0 AN: 44700

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86234

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000719 AC: 8 AN: 1111996

Other (OTH) AF: 0.00 AC: 0 AN: 60394

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000611889), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	not provided (2)
1	-	-	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 10 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.1
Mutation Taster		=8/192	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397514545; hg19: chr12-64202603;