rs397514545

Variant names:

• chr12-63808823-GACGTGATGACAGCTGGCAACTGTGGGAA-G
• rs397514545
• NM_014254.3:c.1064_1091delACGTGATGACAGCTGGCAACTGTGGGAA

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1_Strong PP5_Very_Strong

The NM_014254.3(RXYLT1):​c.1064_1091delACGTGATGACAGCTGGCAACTGTGGGAA​(p.Asp355ValfsTer33) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000547 in 1,461,824 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. D355D) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000055 (0 hom.)
• Consequence: RXYLT1 NM_014254.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 9.09
• Publications: 1 publications found

Genes affected

RXYLT1 (HGNC:13530): (ribitol xylosyltransferase 1) This gene encodes a type II transmembrane protein that is thought to have glycosyltransferase function. Mutations in this gene result in cobblestone lissencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]

RXYLT1-AS1 (HGNC:48910): (RXYLT1 antisense RNA 1)

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.201 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
• PP5: Variant 12-63808823-GACGTGATGACAGCTGGCAACTGTGGGAA-G is Pathogenic according to our data. Variant chr12-63808823-GACGTGATGACAGCTGGCAACTGTGGGAA-G is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 39606.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RXYLT1	NM_014254.3	c.1064_1091delACGTGATGACAGCTGGCAACTGTGGGAA	p.Asp355ValfsTer33	frameshift_variant	Exon 6 of 6	ENST00000261234.11	NP_055069.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RXYLT1	ENST00000261234.11	c.1064_1091delACGTGATGACAGCTGGCAACTGTGGGAA	p.Asp355ValfsTer33	frameshift_variant	Exon 6 of 6	1	NM_014254.3	ENSP00000261234.6

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000796 AC: 2 AN: 251290 AF XY: 0.00000736

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000176

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000547 AC: 8 AN: 1461824 Hom.: 0 AF XY: 0.00000413 AC XY: 3 AN XY: 727206

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33476

American (AMR) AF: 0.00 AC: 0 AN: 44700

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86234

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000719 AC: 8 AN: 1111996

Other (OTH) AF: 0.00 AC: 0 AN: 60394

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000611889), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:2

Jan 27, 2020

Centre for Mendelian Genomics, University Medical Centre Ljubljana

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant was classified as: Pathogenic. The following ACMG criteria were applied in classifying this variant: PVS1,PM2,PP5. -

Dec 18, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Asp355Valfs*33) in the RXYLT1 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 89 amino acid(s) of the RXYLT1 protein. This variant is present in population databases (rs397514545, gnomAD 0.0009%). This premature translational stop signal has been observed in individual(s) with cobblestone lissencephaly (PMID: 23217329). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 39606). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -

Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 10 Pathogenic:1

Dec 07, 2012

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.1
Mutation Taster		=8/192	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397514545; hg19: chr12-64202603;