rs397516670

Variant names:

• chrX-70027984-TCCTCCAGGTCCTCCTGGTCCTCAAGGACCCCCTGG-T
• rs397516670
• NM_001399.5:c.663_697delTCCTCCTGGTCCTCAAGGACCCCCTGGCCTCCAGG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_001399.5(EDA):​c.663_697delTCCTCCTGGTCCTCAAGGACCCCCTGGCCTCCAGG​(p.Pro222ThrfsTer6) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 21)
• Consequence: EDA NM_001399.5 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 9.32

Genes affected

EDA (HGNC:3157): (ectodysplasin A) The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-70027984-TCCTCCAGGTCCTCCTGGTCCTCAAGGACCCCCTGG-T is Pathogenic according to our data. Variant chrX-70027984-TCCTCCAGGTCCTCCTGGTCCTCAAGGACCCCCTGG-T is described in ClinVar as [Pathogenic]. Clinvar id is 44202.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chrX-70027984-TCCTCCAGGTCCTCCTGGTCCTCAAGGACCCCCTGG-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EDA	NM_001399.5	c.663_697delTCCTCCTGGTCCTCAAGGACCCCCTGGCCTCCAGG	p.Pro222ThrfsTer6	frameshift_variant	Exon 4 of 8	ENST00000374552.9	NP_001390.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EDA	ENST00000374552.9	c.663_697delTCCTCCTGGTCCTCAAGGACCCCCTGGCCTCCAGG	p.Pro222ThrfsTer6	frameshift_variant	Exon 4 of 8	1	NM_001399.5	ENSP00000363680.4

Frequencies

GnomAD3 genomes Cov.: 21

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 21

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hypohidrotic X-linked ectodermal dysplasia Pathogenic:2

Oct 02, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Pro222Thrfs*6) in the EDA gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in EDA are known to be pathogenic (PMID: 9683615). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with X-linked hypohidrotic ectodermal dysplasia (PMID: 9683615). In at least one individual the variant was observed to be de novo. This variant is also known as c.904_938del. ClinVar contains an entry for this variant (Variation ID: 44202). For these reasons, this variant has been classified as Pathogenic. -

Sep 27, 2011

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The Pro222fs variant in EDA has not been reported in the literature nor previous ly identified by our laboratory. The Pro222fs variant is predicted to cause a f rameshift, which alters the protein's amino acid sequence beginning at codon 222 and leads to a premature stop codon 6 codons downstream. This alteration is the n predicted to lead to a truncated or absent protein. In summary, this variant m eets our criteria to be classified as pathogenic. -

not provided Pathogenic:1

May 03, 2018

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.663_697del35 variant, which is alternatively described as c.904_938del35 using alternate nomenclature, has been reported previously in patients with HED (Monreal et al., 1998). The variant causes a frameshift starting with codon Proline 222, changing it to a Threonine, and creates a premature Stop codon at position 6 of the new reading frame, denoted p.Pro222ThrfsX6. This pathogenic variant is expected to result in nonsense-mediated mRNA decay or in protein truncation. The variant was not observed in approximately 6,500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project, indicating it is not a common benign variant in these populations. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397516670; hg19: chrX-69247834;