rs397517305

Variant names:

• chr10-71645934-TGGCCATCCCACTGGACTACGA-T
• rs397517305
• NM_022124.6:c.1246_1266delGCCATCCCACTGGACTACGAG

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP3 PP5

The NM_022124.6(CDH23):​c.1246_1266delGCCATCCCACTGGACTACGAG​(p.Ala416_Glu422del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,200 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: CDH23 NM_022124.6 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1
• Conservation: PhyloP100: 9.56

Genes affected

CDH23 (HGNC:13733): (cadherin related 23) This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_022124.6.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 10-71645934-TGGCCATCCCACTGGACTACGA-T is Pathogenic according to our data. Variant chr10-71645934-TGGCCATCCCACTGGACTACGA-T is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 45865.We mark this variant Likely_pathogenic, oryginal submissions are: {Likely_pathogenic=1, Uncertain_significance=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CDH23	NM_022124.6	c.1246_1266delGCCATCCCACTGGACTACGAG	p.Ala416_Glu422del	conservative_inframe_deletion	Exon 13 of 70	ENST00000224721.12	NP_071407.4
CDH23	NM_001171930.2	c.1246_1266delGCCATCCCACTGGACTACGAG	p.Ala416_Glu422del	conservative_inframe_deletion	Exon 13 of 32		NP_001165401.1
CDH23	NM_001171931.2	c.1246_1266delGCCATCCCACTGGACTACGAG	p.Ala416_Glu422del	conservative_inframe_deletion	Exon 13 of 26		NP_001165402.1
CDH23	NM_052836.4	c.1246_1266delGCCATCCCACTGGACTACGAG	p.Ala416_Glu422del	conservative_inframe_deletion	Exon 13 of 14		NP_443068.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CDH23	ENST00000224721.12	c.1246_1266delGCCATCCCACTGGACTACGAG	p.Ala416_Glu422del	conservative_inframe_deletion	Exon 13 of 70	5	NM_022124.6	ENSP00000224721.9

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1461200 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 726890

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000180

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Rare genetic deafness Pathogenic:1

Sep 08, 2013

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The Ala416_Glu422del variant in CDH23 has been identified in an individual with hearing loss by our laboratory who was compound heterozygous. It has not been i dentified in large and broad European American and African American populations by the NHLBI Exome Sequencing Project (http://evs.gs.washington.edu/EVS). This variant causes an in-frame deletion of 7 amino acids conserved in mammals and ac ross evolutionarily distant species, which is likely to impact protein function. I n summary, this variant is likely pathogenic, though additional studies are r equired to fully establish its clinical significance. -

not provided Uncertain:1

Mar 10, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 45865). This variant has not been reported in the literature in individuals affected with CDH23-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.1246_1266del, is a complex sequence change that results in the deletion of 7 amino acid(s) in the CDH23 protein (p.Ala416_Glu422del). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397517305; hg19: chr10-73405691;