rs397517305

Variant names:

• chr10-71645934-TGGCCATCCCACTGGACTACGA-T
• rs397517305
• NM_022124.6:c.1246_1266delGCCATCCCACTGGACTACGAG

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP3 PP5

The NM_022124.6(CDH23):​c.1246_1266delGCCATCCCACTGGACTACGAG​(p.Ala416_Glu422del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,200 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: CDH23 NM_022124.6 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1
• Conservation: PhyloP100: 9.56
• Publications: 0 publications found

Genes affected

CDH23 (HGNC:13733): (cadherin related 23) This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]

CDH23 Gene-Disease associations (from GenCC):

• autosomal recessive nonsyndromic hearing loss 12

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• nonsyndromic genetic hearing loss

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Usher syndrome type 1D

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• Usher syndrome type 1

  Inheritance: Unknown, AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_022124.6.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 10-71645934-TGGCCATCCCACTGGACTACGA-T is Pathogenic according to our data. Variant chr10-71645934-TGGCCATCCCACTGGACTACGA-T is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 45865.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_022124.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CDH23	NM_022124.6	MANE Select	c.1246_1266delGCCATCCCACTGGACTACGAG	p.Ala416_Glu422del	conservative_inframe_deletion	Exon 13 of 70	NP_071407.4
	CDH23	NM_001171930.2		c.1246_1266delGCCATCCCACTGGACTACGAG	p.Ala416_Glu422del	conservative_inframe_deletion	Exon 13 of 32	NP_001165401.1	A0A087WYR8
	CDH23	NM_001171931.2		c.1246_1266delGCCATCCCACTGGACTACGAG	p.Ala416_Glu422del	conservative_inframe_deletion	Exon 13 of 26	NP_001165402.1	Q8N5B3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CDH23	ENST00000224721.12	TSL:5 MANE Select	c.1246_1266delGCCATCCCACTGGACTACGAG	p.Ala416_Glu422del	conservative_inframe_deletion	Exon 13 of 70	ENSP00000224721.9	Q9H251-1
	CDH23	ENST00000616684.4	TSL:5	c.1246_1266delGCCATCCCACTGGACTACGAG	p.Ala416_Glu422del	conservative_inframe_deletion	Exon 13 of 32	ENSP00000482036.2	A0A087WYR8
	CDH23	ENST00000398809.9	TSL:5	c.1246_1266delGCCATCCCACTGGACTACGAG	p.Ala416_Glu422del	conservative_inframe_deletion	Exon 13 of 32	ENSP00000381789.5	A0A0A0MS94

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1461200 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 726890

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33452

American (AMR) AF: 0.00 AC: 0 AN: 44574

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26110

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86174

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53388

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1111700

Other (OTH) AF: 0.00 AC: 0 AN: 60338

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000000000983081), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)
1	-	-	Rare genetic deafness (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.6
Mutation Taster		=11/189	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397517305; hg19: chr10-73405691;