rs397518444

Variant names:

• chr19-2251670-G-GAGCTCAGCGTAGACCTCCGCGCC
• rs397518444
• NM_000479.5:c.1397_1419dupAGCTCAGCGTAGACCTCCGCGCC

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PVS1_Strong PP5

The NM_000479.5(AMH):​c.1397_1419dupAGCTCAGCGTAGACCTCCGCGCC​(p.Glu474SerfsTer4) variant causes a frameshift, stop gained change. The variant allele was found at a frequency of 0.00000412 in 1,455,960 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 34)
  • Exomes 𝑓: 0.0000041 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: AMH NM_000479.5 frameshift, stop_gained
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 3.63
• Publications: 1 publications found

Genes affected

AMH (HGNC:464): (anti-Mullerian hormone) This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate N- and C-terminal cleavage products that homodimerize and associate to form a biologically active noncovalent complex. This complex binds to the anti-Mullerian hormone receptor type 2 and causes the regression of Mullerian ducts in the male embryo that would otherwise differentiate into the uterus and fallopian tubes. This protein also plays a role in Leydig cell differentiation and function and follicular development in adult females. Mutations in this gene result in persistent Mullerian duct syndrome. [provided by RefSeq, Jul 2016]

AMH Gene-Disease associations (from GenCC):

• persistent Mullerian duct syndrome

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.156 CDS is truncated, and there are 3 pathogenic variants in the truncated region.
• PP5: Variant 19-2251670-G-GAGCTCAGCGTAGACCTCCGCGCC is Pathogenic according to our data. Variant chr19-2251670-G-GAGCTCAGCGTAGACCTCCGCGCC is described in ClinVar as Pathogenic. ClinVar VariationId is 8625.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AMH	NM_000479.5	c.1397_1419dupAGCTCAGCGTAGACCTCCGCGCC	p.Glu474SerfsTer4	frameshift_variant, stop_gained	Exon 5 of 5	ENST00000221496.5	NP_000470.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AMH	ENST00000221496.5	c.1397_1419dupAGCTCAGCGTAGACCTCCGCGCC	p.Glu474SerfsTer4	frameshift_variant, stop_gained	Exon 5 of 5	1	NM_000479.5	ENSP00000221496.2
AMH	ENST00000589313.2	n.*63_*64insAGCTCAGCGTAGACCTCCGCGCC		downstream_gene_variant		5

Frequencies

GnomAD3 genomes AF: 0.00000659 AC: 1 AN: 151776 Hom.: 0 Cov.: 34

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000430 AC: 1 AN: 232380 AF XY: 0.00000780

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000987

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000412 AC: 6 AN: 1455960 Hom.: 0 Cov.: 81 AF XY: 0.00000276 AC XY: 2 AN XY: 724344

African (AFR) AF: 0.00 AC: 0 AN: 32958

American (AMR) AF: 0.00 AC: 0 AN: 44526

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25998

East Asian (EAS) AF: 0.00 AC: 0 AN: 39398

South Asian (SAS) AF: 0.00 AC: 0 AN: 85920

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 51060

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5750

European-Non Finnish (NFE) AF: 0.00000540 AC: 6 AN: 1110196

Other (OTH) AF: 0.00 AC: 0 AN: 60154

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000659 AC: 1 AN: 151776 Hom.: 0 Cov.: 34 AF XY: 0.00 AC XY: 0 AN XY: 74130

African (AFR) AF: 0.00 AC: 0 AN: 41362

American (AMR) AF: 0.00 AC: 0 AN: 15256

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5168

South Asian (SAS) AF: 0.00 AC: 0 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10490

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 312

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 67886

Other (OTH) AF: 0.00 AC: 0 AN: 2094

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000756

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Persistent mullerian duct syndrome, type I Pathogenic:1

Nov 01, 2001

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.6
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397518444; hg19: chr19-2251669;