rs398124607
Variant summary
Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP3BP6BS2
The NM_001291867.2(NHS):c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG(p.Glu101_Ala112dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000467 in 1,055,580 control chromosomes in the GnomAD database, including 1 homozygotes. There are 173 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. A113A) has been classified as Likely benign.
Frequency
Consequence
NM_001291867.2 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Nance-Horan syndromeInheritance: XL Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
- early-onset nuclear cataractInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001291867.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| NHS | MANE Select | c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG | p.Glu101_Ala112dup | disruptive_inframe_insertion | Exon 1 of 9 | NP_001278796.1 | Q6T4R5-1 | ||
| NHS | c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG | p.Glu101_Ala112dup | disruptive_inframe_insertion | Exon 1 of 8 | NP_938011.1 | Q6T4R5-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| NHS | MANE Select | c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG | p.Glu101_Ala112dup | disruptive_inframe_insertion | Exon 1 of 9 | ENSP00000502262.1 | Q6T4R5-1 | ||
| NHS | TSL:1 | c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG | p.Glu101_Ala112dup | disruptive_inframe_insertion | Exon 1 of 8 | ENSP00000369400.3 | Q6T4R5-2 |
Frequencies
GnomAD3 genomes AF: 0.000504 AC: 56AN: 111219Hom.: 0 Cov.: 23 show subpopulations
GnomAD4 exome AF: 0.000463 AC: 437AN: 944326Hom.: 1 Cov.: 30 AF XY: 0.000552 AC XY: 165AN XY: 298806 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000503 AC: 56AN: 111254Hom.: 0 Cov.: 23 AF XY: 0.000237 AC XY: 8AN XY: 33798 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.