rs398124607

Positions:

• chrX-17376055-C-CCGGAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGG

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_001291867.2(NHS):​c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG​(p.Glu101_Ala112dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000467 in 1,055,580 control chromosomes in the GnomAD database, including 1 homozygotes. There are 173 hemizygotes in GnomAD. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00050 (0 hom., 8 hem., cov: 23)
  • Exomes 𝑓: 0.00046 (1 hom. 165 hem.)
• Consequence: NHS NM_001291867.2 disruptive_inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:4 B:1
• Conservation: PhyloP100: 0.0890

Genes affected

NHS (HGNC:7820): (NHS actin remodeling regulator) This gene encodes a protein containing four conserved nuclear localization signals. The encoded protein functions in eye, tooth, craniofacial and brain development, and it can regulate actin remodeling and cell morphology. Mutations in this gene have been shown to cause Nance-Horan syndrome, and also X-linked cataract-40. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2014]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High Hemizygotes in GnomAd4 at 8 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
NHS	NM_001291867.2	c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG	p.Glu101_Ala112dup	disruptive_inframe_insertion	1/9	ENST00000676302.1	NP_001278796.1
NHS	NM_198270.4	c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG	p.Glu101_Ala112dup	disruptive_inframe_insertion	1/8		NP_938011.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
NHS	ENST00000676302.1	c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG	p.Glu101_Ala112dup	disruptive_inframe_insertion	1/9		NM_001291867.2	ENSP00000502262.1
NHS	ENST00000380060.7	c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG	p.Glu101_Ala112dup	disruptive_inframe_insertion	1/8	1		ENSP00000369400.3

Frequencies

GnomAD3 genomes AF: 0.000504 AC: 56 AN: 111219 Hom.: 0 Cov.: 23 AF XY: 0.000237 AC XY: 8 AN XY: 33751

Gnomad AFR AF: 0.000163

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00110

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000911

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000463 AC: 437 AN: 944326 Hom.: 1 Cov.: 30 AF XY: 0.000552 AC XY: 165 AN XY: 298806

Gnomad4 AFR exome AF: 0.000103

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000279

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000536

Gnomad4 OTH exome AF: 0.000228

GnomAD4 genome AF: 0.000503 AC: 56 AN: 111254 Hom.: 0 Cov.: 23 AF XY: 0.000237 AC XY: 8 AN XY: 33798

Gnomad4 AFR AF: 0.000162

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00111

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000911

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:4 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:3

Uncertain significance, criteria provided, single submitter	clinical testing	GeneDx	Apr 01, 2022	In-frame insertion of 12 amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge -
Uncertain significance, criteria provided, single submitter	clinical testing	Eurofins Ntd Llc (ga)	Nov 03, 2014	- -
Uncertain significance, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	May 31, 2017	- -

Nance-Horan syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 06, 2025

This variant, c.302_337dup, results in the insertion of 12 amino acid(s) of the NHS protein (p.Glu101_Ala112dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs398124607, gnomAD 0.08%), and has an allele count higher than expected for a pathogenic variant. This variant has not been reported in the literature in individuals affected with NHS-related conditions. ClinVar contains an entry for this variant (Variation ID: 96638). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Inborn genetic diseases Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Ambry Genetics

Nov 09, 2018

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs398124607; hg19: chrX-17394178;