rs398124607

Variant names:

• chrX-17376055-C-CCGGAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGG
• rs398124607
• NM_001291867.2:c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP3 BP6 BS2

The NM_001291867.2(NHS):​c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG​(p.Glu101_Ala112dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000467 in 1,055,580 control chromosomes in the GnomAD database, including 1 homozygotes. There are 173 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. A113A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.00050 (0 hom., 8 hem., cov: 23)
  • Exomes 𝑓: 0.00046 (1 hom. 165 hem.)
• Consequence: NHS NM_001291867.2 disruptive_inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:5 B:2
• Conservation: PhyloP100: 0.0890
• Publications: 0 publications found

Genes affected

NHS (HGNC:7820): (NHS actin remodeling regulator) This gene encodes a protein containing four conserved nuclear localization signals. The encoded protein functions in eye, tooth, craniofacial and brain development, and it can regulate actin remodeling and cell morphology. Mutations in this gene have been shown to cause Nance-Horan syndrome, and also X-linked cataract-40. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2014]

NHS Gene-Disease associations (from GenCC):

• Nance-Horan syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
• early-onset nuclear cataract

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001291867.2
• BP6: Variant X-17376055-C-CCGGAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGG is Benign according to our data. Variant chrX-17376055-C-CCGGAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGG is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 96638.
• BS2: High AC in GnomAd4 at 56 XL,AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001291867.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NHS	NM_001291867.2	MANE Select	c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG	p.Glu101_Ala112dup	disruptive_inframe_insertion	Exon 1 of 9	NP_001278796.1	Q6T4R5-1
	NHS	NM_198270.4		c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG	p.Glu101_Ala112dup	disruptive_inframe_insertion	Exon 1 of 8	NP_938011.1	Q6T4R5-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NHS	ENST00000676302.1	MANE Select	c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG	p.Glu101_Ala112dup	disruptive_inframe_insertion	Exon 1 of 9	ENSP00000502262.1	Q6T4R5-1
	NHS	ENST00000380060.7	TSL:1	c.302_337dupAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGG	p.Glu101_Ala112dup	disruptive_inframe_insertion	Exon 1 of 8	ENSP00000369400.3	Q6T4R5-2

Frequencies

GnomAD3 genomes AF: 0.000504 AC: 56 AN: 111219 Hom.: 0 Cov.: 23

Gnomad AFR AF: 0.000163

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00110

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000911

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000463 AC: 437 AN: 944326 Hom.: 1 Cov.: 30 AF XY: 0.000552 AC XY: 165 AN XY: 298806

African (AFR) AF: 0.000103 AC: 2 AN: 19454

American (AMR) AF: 0.00 AC: 0 AN: 11940

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 14085

East Asian (EAS) AF: 0.00 AC: 0 AN: 21508

South Asian (SAS) AF: 0.000279 AC: 10 AN: 35841

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 23744

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2518

European-Non Finnish (NFE) AF: 0.000536 AC: 416 AN: 775691

Other (OTH) AF: 0.000228 AC: 9 AN: 39545

GnomAD4 genome AF: 0.000503 AC: 56 AN: 111254 Hom.: 0 Cov.: 23 AF XY: 0.000237 AC XY: 8 AN XY: 33798

African (AFR) AF: 0.000162 AC: 5 AN: 30792

American (AMR) AF: 0.00 AC: 0 AN: 10686

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2631

East Asian (EAS) AF: 0.00 AC: 0 AN: 3471

South Asian (SAS) AF: 0.00111 AC: 3 AN: 2713

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 5873

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 214

European-Non Finnish (NFE) AF: 0.000911 AC: 48 AN: 52697

Other (OTH) AF: 0.00 AC: 0 AN: 1502

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	3	-	not provided (3)
-	-	1	Inborn genetic diseases (1)
-	1	-	Nance-Horan syndrome (1)
-	1	-	Nance-Horan syndrome;C4049004:Cataract 40 (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.089
Mutation Taster		=80/20	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs398124607; hg19: chrX-17394178;