rs398124628
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_002049.4(GATA1):c.154_173dupACAGCCACCGCTGCAGCTGC(p.Ala59GlnfsTer85) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A58A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_002049.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- GATA1-Related X-Linked CytopeniaInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- thrombocytopenia, X-linked, with or without dyserythropoietic anemiaInheritance: XL Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- beta-thalassemia-X-linked thrombocytopenia syndromeInheritance: XL Classification: MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
- Diamond-Blackfan anemiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- cutaneous porphyriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- thrombocytopenia with congenital dyserythropoietic anemiaInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked dyserythropoetic anemia with abnormal platelets and neutropeniaInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002049.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GATA1 | TSL:1 MANE Select | c.154_173dupACAGCCACCGCTGCAGCTGC | p.Ala59GlnfsTer85 | frameshift | Exon 2 of 6 | ENSP00000365858.3 | P15976-1 | ||
| GATA1 | c.154_173dupACAGCCACCGCTGCAGCTGC | p.Ala59GlnfsTer85 | frameshift | Exon 2 of 6 | ENSP00000512637.1 | A0A8Q3SIN3 | |||
| GATA1 | TSL:5 | c.154_173dupACAGCCACCGCTGCAGCTGC | p.Ala59GlnfsTer85 | frameshift | Exon 2 of 6 | ENSP00000365853.3 | B7WNQ9 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 22
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.