rs398124628

Variant names:

• chrX-48791260-A-AGCACAGCCACCGCTGCAGCT
• rs398124628
• NM_002049.4:c.154_173dupACAGCCACCGCTGCAGCTGC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_002049.4(GATA1):​c.154_173dupACAGCCACCGCTGCAGCTGC​(p.Ala59GlnfsTer85) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A58A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 22)
• Consequence: GATA1 NM_002049.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 0.565
• Publications: 0 publications found

Genes affected

GATA1 (HGNC:4170): (GATA binding protein 1) This gene encodes a protein which belongs to the GATA family of transcription factors. The protein plays an important role in erythroid development by regulating the switch of fetal hemoglobin to adult hemoglobin. Mutations in this gene have been associated with X-linked dyserythropoietic anemia and thrombocytopenia. [provided by RefSeq, Jul 2008]

GATA1 Gene-Disease associations (from GenCC):

• GATA1-Related X-Linked Cytopenia

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• thrombocytopenia, X-linked, with or without dyserythropoietic anemia

  Inheritance: XL Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• beta-thalassemia-X-linked thrombocytopenia syndrome

  Inheritance: XL Classification: MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
• Diamond-Blackfan anemia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• cutaneous porphyria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• thrombocytopenia with congenital dyserythropoietic anemia

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked dyserythropoetic anemia with abnormal platelets and neutropenia

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000232828 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant X-48791260-A-AGCACAGCCACCGCTGCAGCT is Pathogenic according to our data. Variant chrX-48791260-A-AGCACAGCCACCGCTGCAGCT is described in ClinVar as Pathogenic. ClinVar VariationId is 10429.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002049.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GATA1	NM_002049.4	MANE Select	c.154_173dupACAGCCACCGCTGCAGCTGC	p.Ala59GlnfsTer85	frameshift	Exon 2 of 6	NP_002040.1	P15976-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GATA1	ENST00000376670.9	TSL:1 MANE Select	c.154_173dupACAGCCACCGCTGCAGCTGC	p.Ala59GlnfsTer85	frameshift	Exon 2 of 6	ENSP00000365858.3	P15976-1
	GATA1	ENST00000696450.1		c.154_173dupACAGCCACCGCTGCAGCTGC	p.Ala59GlnfsTer85	frameshift	Exon 2 of 6	ENSP00000512637.1	A0A8Q3SIN3
	GATA1	ENST00000376665.4	TSL:5	c.154_173dupACAGCCACCGCTGCAGCTGC	p.Ala59GlnfsTer85	frameshift	Exon 2 of 6	ENSP00000365853.3	B7WNQ9

Frequencies

GnomAD3 genomes Cov.: 22

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 22

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Acute megakaryoblastic leukemia (1)
1	-	-	Diamond-Blackfan anemia;C1845837:GATA binding protein 1 related thrombocytopenia with dyserythropoiesis (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.56
Mutation Taster		=10/190	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs398124628;

hg19: chrX-48649667;