rs515726173
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1PM4PP3PP5
The NM_000098.3(CPT2):c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT(p.Leu178_Ile186delinsPhe) variant causes a missense, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. L178L) has been classified as Likely benign.
Frequency
Consequence
NM_000098.3 missense, conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- carnitine palmitoyltransferase II deficiencyInheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health, ClinGen
- carnitine palmitoyl transferase II deficiency, neonatal formInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
- carnitine palmitoyl transferase II deficiency, myopathic formInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- carnitine palmitoyl transferase II deficiency, severe infantile formInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- encephalopathy, acute, infection-induced, susceptibility to, 4Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000098.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CPT2 | NM_000098.3 | MANE Select | c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT | p.Leu178_Ile186delinsPhe | missense conservative_inframe_deletion | Exon 4 of 5 | NP_000089.1 | P23786 | |
| CPT2 | NM_001330589.2 | c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT | p.Leu178_Ile186delinsPhe | missense conservative_inframe_deletion | Exon 4 of 5 | NP_001317518.1 | A0A1B0GTB8 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CPT2 | ENST00000371486.4 | TSL:1 MANE Select | c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT | p.Leu178_Ile186delinsPhe | missense conservative_inframe_deletion | Exon 4 of 5 | ENSP00000360541.3 | P23786 | |
| CPT2 | ENST00000873097.1 | c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT | p.Leu178_Ile186delinsPhe | missense conservative_inframe_deletion | Exon 4 of 6 | ENSP00000543156.1 | |||
| CPT2 | ENST00000637252.1 | TSL:5 | c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT | p.Leu178_Ile186delinsPhe | missense conservative_inframe_deletion | Exon 4 of 6 | ENSP00000490492.1 | A0A1B0GVF3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at