rs515726173

Variant names:

• chr1-53210208-GAACCCTGCAAAAAGTGACACTATC-T
• rs515726173
• NM_000098.3:c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_000098.3(CPT2):​c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT​(p.Leu178_Ile186delinsPhe) variant causes a missense, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. L178L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CPT2 NM_000098.3 missense, conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:5 U:1 O:1
• Conservation: PhyloP100: 7.57
• Publications: 0 publications found

Genes affected

CPT2 (HGNC:2330): (carnitine palmitoyltransferase 2) The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]

CPT2 Gene-Disease associations (from GenCC):

• carnitine palmitoyltransferase II deficiency

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen, Myriad Women’s Health
• carnitine palmitoyl transferase II deficiency, myopathic form

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, PanelApp Australia
• carnitine palmitoyl transferase II deficiency, neonatal form

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), PanelApp Australia
• carnitine palmitoyl transferase II deficiency, severe infantile form

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Orphanet
• encephalopathy, acute, infection-induced, susceptibility to, 4

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000236723 (HGNC:):

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a topological_domain Mitochondrial matrix (size 152) in uniprot entity CPT2_HUMAN there are 15 pathogenic changes around while only 4 benign (79%) in NM_000098.3
• PM4: Nonframeshift variant in NON repetitive region in NM_000098.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 1-53210208-GAACCCTGCAAAAAGTGACACTATC-T is Pathogenic according to our data. Variant chr1-53210208-GAACCCTGCAAAAAGTGACACTATC-T is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 130885.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CPT2	NM_000098.3	c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT	p.Leu178_Ile186delinsPhe	missense_variant, conservative_inframe_deletion	Exon 4 of 5	ENST00000371486.4	NP_000089.1
CPT2	NM_001330589.2	c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT	p.Leu178_Ile186delinsPhe	missense_variant, conservative_inframe_deletion	Exon 4 of 5		NP_001317518.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CPT2	ENST00000371486.4	c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT	p.Leu178_Ile186delinsPhe	missense_variant, conservative_inframe_deletion	Exon 4 of 5	1	NM_000098.3	ENSP00000360541.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:5 Uncertain:1 Other:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Pathogenic:1 Uncertain:1

Aug 24, 2017

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.534_558del25insT pathogenic variant in the CPT2 gene results in the deletion of 9 amino acids and the insertion of 1 incorrect amino acid at positions 178 through 186, denoted p.Leu178_Ile186delinsF. This variant has been reported previously in association with carnitine palmitoyltransferase II (CPT2) deficiency in several unrelated individuals who were homozygous for c.534_558del25insT or heterozygous for c.534_558del25insT and another pathogenic variant in the CPT2 gene (Yahyaoui et al., 2011; Yang et al., 1998; Sigauke et al., 2003; Smeets et al., 2003). Therefore, we interpret c.534_558del25insT to be a pathogenic variant. -

Dec 02, 2014

Eurofins Ntd Llc (ga)

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Carnitine palmitoyltransferase II deficiency Pathogenic:1 Other:1

Dec 15, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.534_558delinsT, is a complex sequence change that results in the deletion of 9 and insertion of 1 amino acid(s) in the CPT2 protein (p.Leu178_Ile186delinsPhe). Information on the frequency of this variant in the gnomAD database is not available, as this variant may be reported differently in the database. This variant has been observed in individual(s) with carnitine palmitoyltransferase II deficiency (PMID: 9758712, 12560872, 14615409). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. It has also been observed to segregate with disease in related individuals. This variant is also known as c.534_558delinsT, 534T ins/del25. For these reasons, this variant has been classified as Pathogenic. -

-

GeneReviews

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Carnitine palmitoyl transferase II deficiency, neonatal form Pathogenic:1

Jan 01, 2003

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

CPT2-related disorder Pathogenic:1

Dec 21, 2022

PreventionGenetics, part of Exact Sciences

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The CPT2 c.534_558delinsT variant is predicted to result in an in-frame deletion and insertion. This variant has been reported in the homozygous and compound heterozygous state in individuals with carnitine palmitoyltransferase II deficiency (CTP II) (534T ins/del 25 in Yang et al. 1998. PubMed ID: 9758712; 533_534insT; 534_558-del in Sigauke et al. 2003. PubMed ID: 14615409; 534T ins/del 25 in Smeets et al. 2003. PubMed ID: 12560872; Yahyaoui et al. 2011. PubMed ID: 21641254; Fanin et al. 2012. PubMed ID: 21913903). This variant is interpreted as pathogenic. -

Encephalopathy, acute, infection-induced, susceptibility to, 4 Pathogenic:1

Mar 30, 2024

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs515726173; hg19: chr1-53675880;