rs515726173

Positions:

• chr1-53210207-TGAACCCTGCAAAAAGTGACACTATC-TT

Variant summary

Our verdict is Pathogenic. Variant got 19 ACMG points: 19P and 0B. PS1 PM1 PM2 PM4 PP3 PP5_Very_Strong

The NM_000098.3(CPT2):​c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT​(p.Leu178_Ile186delinsPhe) variant causes a missense, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Another nucleotide change resulting in same amino acid change has been previously reported as Pathogenicin Lovd. Synonymous variant affecting the same amino acid position (i.e. L178L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CPT2 NM_000098.3 missense, conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:5 U:1 O:1
• Conservation: PhyloP100: 7.57

Genes affected

CPT2 (HGNC:2330): (carnitine palmitoyltransferase 2) The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]

CPT2 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 19 ACMG points.

• PS1: Transcript NM_000098.3 (CPT2) is affected with MISSENSE_VARIANT having same AA change as one Pathogenic present in Lovd
• PM1: In a topological_domain Mitochondrial matrix (size 152) in uniprot entity CPT2_HUMAN there are 20 pathogenic changes around while only 5 benign (80%) in NM_000098.3
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000098.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 1-53210208-GAACCCTGCAAAAAGTGACACTATC-T is Pathogenic according to our data. Variant chr1-53210208-GAACCCTGCAAAAAGTGACACTATC-T is described in ClinVar as [Pathogenic]. Clinvar id is 130885.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CPT2	NM_000098.3	c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT	p.Leu178_Ile186delinsPhe	missense_variant, conservative_inframe_deletion	4/5	ENST00000371486.4	NP_000089.1
CPT2	NM_001330589.2	c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT	p.Leu178_Ile186delinsPhe	missense_variant, conservative_inframe_deletion	4/5		NP_001317518.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CPT2	ENST00000371486.4	c.534_558delGAACCCTGCAAAAAGTGACACTATCinsT	p.Leu178_Ile186delinsPhe	missense_variant, conservative_inframe_deletion	4/5	1	NM_000098.3	ENSP00000360541.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:5 Uncertain:1 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:1 Uncertain:1

Uncertain significance, flagged submission	clinical testing	Eurofins Ntd Llc (ga)	Dec 02, 2014	- -
Pathogenic, criteria provided, single submitter	clinical testing	GeneDx	Aug 24, 2017	The c.534_558del25insT pathogenic variant in the CPT2 gene results in the deletion of 9 amino acids and the insertion of 1 incorrect amino acid at positions 178 through 186, denoted p.Leu178_Ile186delinsF. This variant has been reported previously in association with carnitine palmitoyltransferase II (CPT2) deficiency in several unrelated individuals who were homozygous for c.534_558del25insT or heterozygous for c.534_558del25insT and another pathogenic variant in the CPT2 gene (Yahyaoui et al., 2011; Yang et al., 1998; Sigauke et al., 2003; Smeets et al., 2003). Therefore, we interpret c.534_558del25insT to be a pathogenic variant. -

Carnitine palmitoyltransferase II deficiency Pathogenic:1 Other:1

not provided, no classification provided	literature only	GeneReviews	-	- -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Nov 16, 2018	This variant, c.534_558delinsT, is a complex sequence change that results in the deletion of 9 amino acids and the insertion of 1 amino acid of the CPT2 protein (p.Leu178_Ile186delinsPhe), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs772240606, ExAC 0.01%). This variant has been observed to be homozygous or in combination with another CPT2 variant in individuals affected with carnitine palmitoyltransferase II deficiency (PMID: 9758712, 14615409, 21641254), and has been shown to segregate with disease in a family (PMID: 12560872). This variant is also known as 534T ins/del 25 in the literature. ClinVar contains an entry for this variant (Variation ID: 130885). Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acid(s) is currently unknown. For these reasons, this variant has been classified as Pathogenic. -

Carnitine palmitoyl transferase II deficiency, neonatal form Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Jan 01, 2003

- -

Encephalopathy, acute, infection-induced, susceptibility to, 4 Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Baylor Genetics

Mar 30, 2024

- -

CPT2-related disorder Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

PreventionGenetics, part of Exact Sciences

Dec 21, 2022

The CPT2 c.534_558delinsT variant is predicted to result in an in-frame deletion and insertion. This variant has been reported in the homozygous and compound heterozygous state in individuals with carnitine palmitoyltransferase II deficiency (CTP II) (534T ins/del 25 in Yang et al. 1998. PubMed ID: 9758712; 533_534insT; 534_558-del in Sigauke et al. 2003. PubMed ID: 14615409; 534T ins/del 25 in Smeets et al. 2003. PubMed ID: 12560872; Yahyaoui et al. 2011. PubMed ID: 21641254; Fanin et al. 2012. PubMed ID: 21913903). This variant is interpreted as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs515726173; hg19: chr1-53675880;