rs515726210
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 17P and 1B. PS3PM1PM4PP3PP5_Very_StrongBS2_Supporting
The NM_007272.3(CTRC):c.738_761delCAAGAAGCCGGTAGTCTACACCCG(p.Lys247_Arg254del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000756 in 1,614,036 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV000630756: Experimental studies have shown that this variant affects CTRC function (PMID:18059268, 22942235)." and additional evidence is available in ClinVar. Synonymous variant affecting the same amino acid position (i.e. R246R) has been classified as Likely benign.
Frequency
Consequence
NM_007272.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- hereditary chronic pancreatitisInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_007272.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CTRC | TSL:1 MANE Select | c.738_761delCAAGAAGCCGGTAGTCTACACCCG | p.Lys247_Arg254del | disruptive_inframe_deletion | Exon 7 of 8 | ENSP00000365116.4 | Q99895 | ||
| CTRC | TSL:1 | c.*192_*215delCAAGAAGCCGGTAGTCTACACCCG | 3_prime_UTR | Exon 4 of 5 | ENSP00000365110.2 | Q68DR9 | |||
| CTRC | TSL:5 | n.502_525delCAAGAAGCCGGTAGTCTACACCCG | non_coding_transcript_exon | Exon 5 of 6 |
Frequencies
GnomAD3 genomes AF: 0.0000789 AC: 12AN: 152168Hom.: 0 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.0000756 AC: 19AN: 251286 AF XY: 0.0000662 show subpopulations
GnomAD4 exome AF: 0.0000752 AC: 110AN: 1461868Hom.: 0 AF XY: 0.0000811 AC XY: 59AN XY: 727234 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000789 AC: 12AN: 152168Hom.: 0 Cov.: 33 AF XY: 0.0000942 AC XY: 7AN XY: 74330 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at