rs515726210
Variant summary
Our verdict is Pathogenic. Variant got 13 ACMG points: 13P and 0B. PM2PM4PP3PP5_Very_Strong
The NM_007272.3(CTRC):c.738_761delCAAGAAGCCGGTAGTCTACACCCG(p.Lys247_Arg254del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000756 in 1,614,036 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. R246R) has been classified as Likely benign.
Frequency
Consequence
NM_007272.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 13 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CTRC | NM_007272.3 | c.738_761delCAAGAAGCCGGTAGTCTACACCCG | p.Lys247_Arg254del | disruptive_inframe_deletion | 7/8 | ENST00000375949.5 | NP_009203.2 | |
CTRC | XM_011540550.2 | c.592_615delCAAGAAGCCGGTAGTCTACACCCG | p.Gln198_Pro205del | conservative_inframe_deletion | 6/7 | XP_011538852.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CTRC | ENST00000375949.5 | c.738_761delCAAGAAGCCGGTAGTCTACACCCG | p.Lys247_Arg254del | disruptive_inframe_deletion | 7/8 | 1 | NM_007272.3 | ENSP00000365116.4 | ||
CTRC | ENST00000375943.6 | c.*192_*215delCAAGAAGCCGGTAGTCTACACCCG | 3_prime_UTR_variant | 4/5 | 1 | ENSP00000365110.2 | ||||
CTRC | ENST00000483406.1 | n.502_525delCAAGAAGCCGGTAGTCTACACCCG | non_coding_transcript_exon_variant | 5/6 | 5 |
Frequencies
GnomAD3 genomes AF: 0.0000789 AC: 12AN: 152168Hom.: 0 Cov.: 33
GnomAD3 exomes AF: 0.0000756 AC: 19AN: 251286Hom.: 0 AF XY: 0.0000662 AC XY: 9AN XY: 135864
GnomAD4 exome AF: 0.0000752 AC: 110AN: 1461868Hom.: 0 AF XY: 0.0000811 AC XY: 59AN XY: 727234
GnomAD4 genome AF: 0.0000789 AC: 12AN: 152168Hom.: 0 Cov.: 33 AF XY: 0.0000942 AC XY: 7AN XY: 74330
ClinVar
Submissions by phenotype
Hereditary pancreatitis Pathogenic:3Other:1
not provided, no classification provided | literature only | GeneReviews | - | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Baylor Genetics | Jan 31, 2023 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Sep 12, 2022 | The c.738_761del24 pathogenic mutation (also known as p.K247_R254del) is located in coding exon 7 of the CTRC gene. This mutation results from an in-frame deletion of 24 nucleotides between positions 738 and 761. This results in the deletion of 8 amino acids between codons 247 and 254. In one study, this mutation was significantly overrepresented in the pancreatitis group compared to controls (Rosendahl J et al. Nat. Genet., 2008 Jan;40:78-82). In another study of individuals of European origin, this mutation was detected in 15/1739 (0.86%) affected individuals and 5/3586 (0.14%) controls (Beer S et al. Gut, 2013 Nov;62:1616-24). In vitro functional studies showed that protein with this variant is catalytically inactive, poorly secreted, and readily degraded by low concentrations of trypsin; the loss of function is hypothesized to increase the risk for chronic pancreatitis (Rosendahl J et al. Nat. Genet., 2008 Jan;40:78-82; Beer S et al. Gut, 2013 Nov;62:1616-24). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. - |
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jan 02, 2024 | This variant, c.738_761del, results in the deletion of 8 amino acid(s) of the CTRC protein (p.Lys247_Arg254del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs746224507, gnomAD 0.01%). This variant has been observed in individual(s) with CTRC-associated pancreatitis, especially in the European population. In a compiled analysis of four case-control studies involving 1,739 cases and 3,686 controls, this variant was significantly associated with increased risk for pancreatitis (PMID: 18059268, 18172691, 20625975, 22427236, 22942235). ClinVar contains an entry for this variant (Variation ID: 132150). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects CTRC function (PMID: 18059268, 22942235). For these reasons, this variant has been classified as Pathogenic. - |
not provided Pathogenic:2
Pathogenic, criteria provided, single submitter | clinical testing | Knight Diagnostic Laboratories, Oregon Health and Sciences University | Nov 18, 2019 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital | Dec 17, 2022 | - - |
not specified Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories | Nov 20, 2016 | - - |
Pancreatitis, chronic, susceptibility to Other:1
risk factor, no assertion criteria provided | literature only | OMIM | Feb 01, 2008 | - - |
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at