rs530117757

chr2-232531264-GGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT-Gchr2-232531264-GGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT-GGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCTGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BA1

The NM_000751.3(CHRND):c.821-52_821-18del variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.166 in 948,954 control chromosomes in the GnomAD database, including 10,681 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.16 (2161 hom., cov: 28)
  • Exomes 𝑓: 0.17 (8520 hom.)
• Consequence: CHRND NM_000751.3 intron
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 0.301

Genes affected

CHRND (HGNC:1965): (cholinergic receptor nicotinic delta subunit) The acetylcholine receptor of muscle has 5 subunits of 4 different types: 2 alpha and 1 each of beta, gamma and delta subunits. After acetylcholine binding, the receptor undergoes an extensive conformation change that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. Defects in this gene are a cause of multiple pterygium syndrome lethal type (MUPSL), congenital myasthenic syndrome slow-channel type (SCCMS), and congenital myasthenic syndrome fast-channel type (FCCMS). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant 2-232531264-GGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT-G is Benign according to our data. Variant chr2-232531264-GGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT-G is described in ClinVar as [Likely_benign]. Clinvar id is 256783.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.215 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
CHRND	NM_000751.3	c.821-52_821-18del		intron_variant		ENST00000258385.8
CHRND	NM_001256657.2	c.776-52_776-18del		intron_variant
CHRND	NM_001311195.2	c.239-52_239-18del		intron_variant
CHRND	NM_001311196.2	c.518-52_518-18del		intron_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
CHRND	ENST00000258385.8	c.821-52_821-18del		intron_variant		1	NM_000751.3	P1

Frequencies

GnomAD3 genomes AF: 0.162 AC: 24507 AN: 151292 Hom.: 2162 Cov.: 28

Gnomad AFR AF: 0.219

Gnomad AMI AF: 0.0779

Gnomad AMR AF: 0.121

Gnomad ASJ AF: 0.204

Gnomad EAS AF: 0.0472

Gnomad SAS AF: 0.160

Gnomad FIN AF: 0.176

Gnomad MID AF: 0.222

Gnomad NFE AF: 0.142

Gnomad OTH AF: 0.162

GnomAD4 exome AF: 0.167 AC: 133061 AN: 797542 Hom.: 8520 AF XY: 0.165 AC XY: 69624 AN XY: 421254

Gnomad4 AFR exome AF: 0.242

Gnomad4 AMR exome AF: 0.0866

Gnomad4 ASJ exome AF: 0.206

Gnomad4 EAS exome AF: 0.0748

Gnomad4 SAS exome AF: 0.168

Gnomad4 FIN exome AF: 0.174

Gnomad4 NFE exome AF: 0.174

Gnomad4 OTH exome AF: 0.165

GnomAD4 genome AF: 0.162 AC: 24515 AN: 151412 Hom.: 2161 Cov.: 28 AF XY: 0.162 AC XY: 11996 AN XY: 73964

Gnomad4 AFR AF: 0.219

Gnomad4 AMR AF: 0.121

Gnomad4 ASJ AF: 0.204

Gnomad4 EAS AF: 0.0473

Gnomad4 SAS AF: 0.158

Gnomad4 FIN AF: 0.176

Gnomad4 NFE AF: 0.142

Gnomad4 OTH AF: 0.160

Alfa AF: 0.149 Hom.: 199

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

Likely benign, criteria provided, single submitter

clinical testing

PreventionGenetics, part of Exact Sciences

-

- -

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

GeneDx

Jul 08, 2018

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs530117757; hg19: chr2-233395974;