rs534329317

Variant names:

• chr16-89282043-TGCTCGTCCCTGTGATGCCGCAGGA-T
• rs534329317
• NM_013275.6:c.4475_4498delTCCTGCGGCATCACAGGGACGAGC

Your query was ambiguous. Multiple possible variants found:

• chr16-89282043-TGCTCGTCCCTGTGATGCCGCAGGA-T
• chr16-89282043-TGCTCGTCCCTGTGATGCCGCAGGA-TGCTCGTCCCTGTGATGCCGCAGGAGCTCGTCCCTGTGATGCCGCAGGA

Variant summary

Our verdict is Benign. The variant received -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BS1 BS2

The NM_013275.6(ANKRD11):​c.4475_4498delTCCTGCGGCATCACAGGGACGAGC​(p.Leu1492_Glu1499del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000493 in 1,613,712 control chromosomes in the GnomAD database, including 2 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.00043 (1 hom., cov: 32)
  • Exomes 𝑓: 0.00050 (1 hom.)
• Consequence: ANKRD11 NM_013275.6 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:5
• Conservation: PhyloP100: 0.291
• Publications: 0 publications found

Genes affected

ANKRD11 (HGNC:21316): (ankyrin repeat domain containing 11) This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]

ANKRD11 Gene-Disease associations (from GenCC):

• KBG syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, G2P, Illumina, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
• congenital heart defects, multiple types

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Benign. The variant received -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_013275.6.
• BP6: Variant 16-89282043-TGCTCGTCCCTGTGATGCCGCAGGA-T is Benign according to our data. Variant chr16-89282043-TGCTCGTCCCTGTGATGCCGCAGGA-T is described in ClinVar as Likely_benign. ClinVar VariationId is 772792.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.000434 (66/152238) while in subpopulation SAS AF = 0.00311 (15/4816). AF 95% confidence interval is 0.00192. There are 1 homozygotes in GnomAd4. There are 36 alleles in the male GnomAd4 subpopulation. Median coverage is 32. This position passed quality control check.
• BS2: High AC in GnomAd4 at 66 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_013275.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ANKRD11	NM_013275.6	MANE Select	c.4475_4498delTCCTGCGGCATCACAGGGACGAGC	p.Leu1492_Glu1499del	disruptive_inframe_deletion	Exon 9 of 13	NP_037407.4
	ANKRD11	NM_001256182.2		c.4475_4498delTCCTGCGGCATCACAGGGACGAGC	p.Leu1492_Glu1499del	disruptive_inframe_deletion	Exon 10 of 14	NP_001243111.1	Q6UB99
	ANKRD11	NM_001256183.2		c.4475_4498delTCCTGCGGCATCACAGGGACGAGC	p.Leu1492_Glu1499del	disruptive_inframe_deletion	Exon 9 of 13	NP_001243112.1	Q6UB99

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ANKRD11	ENST00000301030.10	TSL:5 MANE Select	c.4475_4498delTCCTGCGGCATCACAGGGACGAGC	p.Leu1492_Glu1499del	disruptive_inframe_deletion	Exon 9 of 13	ENSP00000301030.4	Q6UB99
	ANKRD11	ENST00000378330.7	TSL:1	c.4475_4498delTCCTGCGGCATCACAGGGACGAGC	p.Leu1492_Glu1499del	disruptive_inframe_deletion	Exon 10 of 14	ENSP00000367581.2	Q6UB99
	ANKRD11	ENST00000642600.2		c.4475_4498delTCCTGCGGCATCACAGGGACGAGC	p.Leu1492_Glu1499del	disruptive_inframe_deletion	Exon 9 of 13	ENSP00000495226.1	Q6UB99

Frequencies

GnomAD3 genomes AF: 0.000434 AC: 66 AN: 152120 Hom.: 1 Cov.: 32

Gnomad AFR AF: 0.0000966

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000720

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00311

Gnomad FIN AF: 0.0000942

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000500

Gnomad OTH AF: 0.000478

GnomAD2 exomes AF: 0.000697 AC: 175 AN: 250986 AF XY: 0.000869

Gnomad AFR exome AF: 0.000123

Gnomad AMR exome AF: 0.000694

Gnomad ASJ exome AF: 0.0000994

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000607

Gnomad OTH exome AF: 0.000489

GnomAD4 exome AF: 0.000499 AC: 730 AN: 1461474 Hom.: 1 AF XY: 0.000600 AC XY: 436 AN XY: 727042

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000119 AC: 4 AN: 33480

American (AMR) AF: 0.000581 AC: 26 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.0000383 AC: 1 AN: 26134

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39700

South Asian (SAS) AF: 0.00268 AC: 231 AN: 86258

European-Finnish (FIN) AF: 0.0000377 AC: 2 AN: 53010

Middle Eastern (MID) AF: 0.000520 AC: 3 AN: 5768

European-Non Finnish (NFE) AF: 0.000396 AC: 440 AN: 1112008

Other (OTH) AF: 0.000364 AC: 22 AN: 60392

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000434 AC: 66 AN: 152238 Hom.: 1 Cov.: 32 AF XY: 0.000484 AC XY: 36 AN XY: 74432

African (AFR) AF: 0.0000963 AC: 4 AN: 41546

American (AMR) AF: 0.000719 AC: 11 AN: 15292

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5170

South Asian (SAS) AF: 0.00311 AC: 15 AN: 4816

European-Finnish (FIN) AF: 0.0000942 AC: 1 AN: 10614

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.000500 AC: 34 AN: 68010

Other (OTH) AF: 0.000473 AC: 1 AN: 2112

Alfa AF: 0.000218 Hom.: 0

Bravo AF: 0.000291

Asia WGS AF: 0.000866 AC: 3 AN: 3478

EpiCase AF: 0.000491

EpiControl AF: 0.000711

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	KBG syndrome (2)
-	-	1	ANKRD11-related disorder (1)
-	-	1	Inborn genetic diseases (1)
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.29
Mutation Taster		=147/53	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs534329317; hg19: chr16-89348451;