rs535089924

Variant names:

• chr18-79988580-ACGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAG-A
• rs535089924
• ENST00000585474.5:c.-60-10913_-60-10880delCTAGCGCGCGCGCATGCCGTCAGCACGCACGGCG

Your query was ambiguous. Multiple possible variants found:

• chr18-79988580-ACGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAG-A
• chr18-79988580-ACGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAG-ACGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAG
• chr18-79988580-ACGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAG-ACGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 8P and 5B. PP5_Very_Strong BS1_Supporting BS2

The NM_001305563.2(TXNL4A):​c.-60-10913_-60-10880delCTAGCGCGCGCGCATGCCGTCAGCACGCACGGCG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00418 in 516,266 control chromosomes in the GnomAD database, including 9 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.0047 (3 hom., cov: 34)
  • Exomes 𝑓: 0.0040 (6 hom.)
• Consequence: TXNL4A NM_001305563.2 intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:9 U:1 O:1
• Conservation: PhyloP100: 0.206
• Publications: 0 publications found

Genes affected

TXNL4A (HGNC:30551): (thioredoxin like 4A) The protein encoded by this gene is a member of the U5 small ribonucleoprotein particle (snRNP), and is involved in pre-mRNA splicing. This protein contains a thioredoxin-like fold and it is expected to interact with multiple proteins. Protein-protein interactions have been observed with the polyglutamine tract-binding protein 1 (PQBP1). Mutations in both the coding region and promoter region of this gene have been associated with Burn-McKeown syndrome, which is a rare disorder characterized by craniofacial dysmorphisms, cardiac defects, hearing loss, and bilateral choanal atresia. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]

TXNL4A Gene-Disease associations (from GenCC):

• choanal atresia-hearing loss-cardiac defects-craniofacial dysmorphism syndrome

  Inheritance: AR, Unknown Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: G2P, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PP5: Variant 18-79988580-ACGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAG-A is Pathogenic according to our data. Variant chr18-79988580-ACGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAG-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 162203.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population amr. GnomAd4 allele frequency = 0.00468 (710/151694) while in subpopulation AMR AF = 0.0074 (113/15278). AF 95% confidence interval is 0.00629. There are 3 homozygotes in GnomAd4. There are 354 alleles in the male GnomAd4 subpopulation. Median coverage is 34. This position passed quality control check. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting
• BS2: High Homozygotes in GnomAd4 at 3 AR,Unknown gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001305563.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TXNL4A	NM_001305563.2		c.-60-10913_-60-10880delCTAGCGCGCGCGCATGCCGTCAGCACGCACGGCG		intron	N/A	NP_001292492.1	K7ESL1
	TXNL4A	NM_001305564.2		c.-60-10913_-60-10880delCTAGCGCGCGCGCATGCCGTCAGCACGCACGGCG		intron	N/A	NP_001292493.1	K7ESL1
	TXNL4A	NM_006701.5	MANE Select	c.-222_-189delCTAGCGCGCGCGCATGCCGTCAGCACGCACGGCG		upstream_gene	N/A	NP_006692.1	P83876

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TXNL4A	ENST00000585474.5	TSL:1	c.-60-10913_-60-10880delCTAGCGCGCGCGCATGCCGTCAGCACGCACGGCG		intron	N/A	ENSP00000465572.1	K7ESL1
	TXNL4A	ENST00000592957.1	TSL:3	c.-60-10913_-60-10880delCTAGCGCGCGCGCATGCCGTCAGCACGCACGGCG		intron	N/A	ENSP00000465493.1	K7ESL1
	TXNL4A	ENST00000585769.5	TSL:2	n.-222_-189delCTAGCGCGCGCGCATGCCGTCAGCACGCACGGCG		non_coding_transcript_exon	Exon 1 of 5	ENSP00000466266.1	K7EPA6

Frequencies

GnomAD3 genomes AF: 0.00468 AC: 709 AN: 151586 Hom.: 3 Cov.: 34

Gnomad AFR AF: 0.00321

Gnomad AMI AF: 0.0110

Gnomad AMR AF: 0.00741

Gnomad ASJ AF: 0.0202

Gnomad EAS AF: 0.00137

Gnomad SAS AF: 0.00146

Gnomad FIN AF: 0.00142

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00506

Gnomad OTH AF: 0.00528

GnomAD4 exome AF: 0.00397 AC: 1449 AN: 364572 Hom.: 6 AF XY: 0.00405 AC XY: 736 AN XY: 181734

African (AFR) AF: 0.00131 AC: 11 AN: 8386

American (AMR) AF: 0.00431 AC: 28 AN: 6496

Ashkenazi Jewish (ASJ) AF: 0.0159 AC: 139 AN: 8752

East Asian (EAS) AF: 0.00107 AC: 22 AN: 20546

South Asian (SAS) AF: 0.000763 AC: 6 AN: 7860

European-Finnish (FIN) AF: 0.00166 AC: 34 AN: 20538

Middle Eastern (MID) AF: 0.00698 AC: 10 AN: 1432

European-Non Finnish (NFE) AF: 0.00404 AC: 1096 AN: 271322

Other (OTH) AF: 0.00535 AC: 103 AN: 19240

GnomAD4 genome AF: 0.00468 AC: 710 AN: 151694 Hom.: 3 Cov.: 34 AF XY: 0.00477 AC XY: 354 AN XY: 74186

African (AFR) AF: 0.00322 AC: 133 AN: 41250

American (AMR) AF: 0.00740 AC: 113 AN: 15278

Ashkenazi Jewish (ASJ) AF: 0.0202 AC: 70 AN: 3466

East Asian (EAS) AF: 0.00137 AC: 7 AN: 5104

South Asian (SAS) AF: 0.00146 AC: 7 AN: 4786

European-Finnish (FIN) AF: 0.00142 AC: 15 AN: 10586

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.00506 AC: 344 AN: 67922

Other (OTH) AF: 0.00523 AC: 11 AN: 2104

Alfa AF: 0.00435 Hom.: 0

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
7	1	-	Choanal atresia-hearing loss-cardiac defects-craniofacial dysmorphism syndrome (9)
2	-	-	not provided (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.21
Mutation Taster		=42/58	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs535089924; hg19: chr18-77748580;