rs550067660

Variant names:

• chr11-6390700-CCTGGTGCTGGCGCTGGCGCTGGCG-C
• rs550067660
• NM_000543.5:c.107_130delTGCTGGCGCTGGCGCTGGCGCTGG

Variant summary

Our verdict is Benign. The variant received -13 ACMG points: 0P and 13B. BP3 BP6_Very_Strong BS2

The NM_000543.5(SMPD1):​c.107_130delTGCTGGCGCTGGCGCTGGCGCTGG​(p.Val36_Leu43del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00125 in 1,546,828 control chromosomes in the GnomAD database, including 13 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. V36V) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.00098 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0013 (13 hom.)
• Consequence: SMPD1 NM_000543.5 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 1.67
• Publications: 2 publications found

Genes affected

SMPD1 (HGNC:11120): (sphingomyelin phosphodiesterase 1) The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]

SMPD1 Gene-Disease associations (from GenCC):

• acid sphingomyelinase deficiency

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Niemann-Pick disease

  Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
• Niemann-Pick disease type A

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, PanelApp Australia, G2P
• Niemann-Pick disease type B

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Genomics England PanelApp, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Benign. The variant received -13 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000543.5
• BP6: Variant 11-6390700-CCTGGTGCTGGCGCTGGCGCTGGCG-C is Benign according to our data. Variant chr11-6390700-CCTGGTGCTGGCGCTGGCGCTGGCG-C is described in ClinVar as Likely_benign. ClinVar VariationId is 459633.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAdExome4 at 13 AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000543.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMPD1	NM_000543.5	MANE Select	c.107_130delTGCTGGCGCTGGCGCTGGCGCTGG	p.Val36_Leu43del	disruptive_inframe_deletion	Exon 1 of 6	NP_000534.3
	SMPD1	NM_001007593.3		c.107_130delTGCTGGCGCTGGCGCTGGCGCTGG	p.Val36_Leu43del	disruptive_inframe_deletion	Exon 1 of 6	NP_001007594.2	P17405-4
	SMPD1	NM_001365135.2		c.107_130delTGCTGGCGCTGGCGCTGGCGCTGG	p.Val36_Leu43del	disruptive_inframe_deletion	Exon 1 of 5	NP_001352064.1	P17405-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMPD1	ENST00000342245.9	TSL:1 MANE Select	c.107_130delTGCTGGCGCTGGCGCTGGCGCTGG	p.Val36_Leu43del	disruptive_inframe_deletion	Exon 1 of 6	ENSP00000340409.4	P17405-1
	SMPD1	ENST00000531303.5	TSL:1	n.107_130delTGCTGGCGCTGGCGCTGGCGCTGG		non_coding_transcript_exon	Exon 1 of 6	ENSP00000432625.1	E9PPK6
	SMPD1	ENST00000533123.5	TSL:1	n.107_130delTGCTGGCGCTGGCGCTGGCGCTGG		non_coding_transcript_exon	Exon 1 of 5	ENSP00000435950.1	G3V1E1

Frequencies

GnomAD3 genomes AF: 0.000970 AC: 135 AN: 139132 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000159

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000909

Gnomad ASJ AF: 0.00387

Gnomad EAS AF: 0.000415

Gnomad SAS AF: 0.00713

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00719

Gnomad NFE AF: 0.00110

Gnomad OTH AF: 0.000527

GnomAD2 exomes AF: 0.00188 AC: 437 AN: 232506 AF XY: 0.00202

Gnomad AFR exome AF: 0.000485

Gnomad AMR exome AF: 0.00155

Gnomad ASJ exome AF: 0.00299

Gnomad EAS exome AF: 0.000466

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00120

Gnomad OTH exome AF: 0.00140

GnomAD4 exome AF: 0.00127 AC: 1792 AN: 1407592 Hom.: 13 AF XY: 0.00147 AC XY: 1032 AN XY: 700352

African (AFR) AF: 0.000483 AC: 16 AN: 33120

American (AMR) AF: 0.00144 AC: 62 AN: 43060

Ashkenazi Jewish (ASJ) AF: 0.00383 AC: 97 AN: 25308

East Asian (EAS) AF: 0.000446 AC: 16 AN: 35858

South Asian (SAS) AF: 0.00713 AC: 588 AN: 82504

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 49790

Middle Eastern (MID) AF: 0.00392 AC: 22 AN: 5606

European-Non Finnish (NFE) AF: 0.000822 AC: 883 AN: 1074300

Other (OTH) AF: 0.00186 AC: 108 AN: 58046

GnomAD4 genome AF: 0.000977 AC: 136 AN: 139236 Hom.: 0 Cov.: 0 AF XY: 0.00102 AC XY: 69 AN XY: 67722

African (AFR) AF: 0.000158 AC: 6 AN: 37866

American (AMR) AF: 0.000907 AC: 13 AN: 14326

Ashkenazi Jewish (ASJ) AF: 0.00387 AC: 13 AN: 3362

East Asian (EAS) AF: 0.000416 AC: 2 AN: 4804

South Asian (SAS) AF: 0.00739 AC: 30 AN: 4062

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 8950

Middle Eastern (MID) AF: 0.00781 AC: 2 AN: 256

European-Non Finnish (NFE) AF: 0.00110 AC: 69 AN: 62990

Other (OTH) AF: 0.000521 AC: 1 AN: 1920

Alfa AF: 0.00169 Hom.: 0

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	1	Niemann-Pick disease, type A;C0268243:Niemann-Pick disease, type B (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.7
Mutation Taster		=198/2	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs550067660; hg19: chr11-6411930; COSMIC: COSV54969663;