rs56393982

Variant names:

• chr14-75017201-T-TCTATGGGAAGAAAGAATAACTTCAATTAGCAATATGA
• rs56393982
• NM_001040108.2:c.4243-37_4243-1dupTCATATTGCTAATTGAAGTTATTCTTTCTTCCCATAG

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 8P and 16B. PVS1 BP6_Very_Strong BS1 BS2

The NM_001040108.2(MLH3):​c.4243-37_4243-1dupTCATATTGCTAATTGAAGTTATTCTTTCTTCCCATAG variant causes a splice acceptor, intron change. The variant allele was found at a frequency of 0.000954 in 1,613,478 control chromosomes in the GnomAD database, including 11 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0056 (6 hom., cov: 33)
  • Exomes 𝑓: 0.00047 (5 hom.)
• Consequence: MLH3 NM_001040108.2 splice_acceptor, intron
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 5.46
• Publications: 0 publications found

Genes affected

MLH3 (HGNC:7128): (mutL homolog 3) This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]

MLH3 Gene-Disease associations (from GenCC):

• colorectal cancer, hereditary nonpolyposis, type 7

  Inheritance: AD, AR Classification: MODERATE, LIMITED Submitted by: Ambry Genetics, ClinGen, Laboratory for Molecular Medicine
• intestinal polyposis syndrome

  Inheritance: AR Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease,
• BP6: Variant 14-75017201-T-TCTATGGGAAGAAAGAATAACTTCAATTAGCAATATGA is Benign according to our data. Variant chr14-75017201-T-TCTATGGGAAGAAAGAATAACTTCAATTAGCAATATGA is described in ClinVar as Benign. ClinVar VariationId is 238249.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population afr. GnomAd4 allele frequency = 0.0056 (853/152224) while in subpopulation AFR AF = 0.0198 (820/41472). AF 95% confidence interval is 0.0187. There are 6 homozygotes in GnomAd4. There are 390 alleles in the male GnomAd4 subpopulation. Median coverage is 33. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 6 AD,AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001040108.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MLH3	NM_001040108.2	MANE Select	c.4243-37_4243-1dupTCATATTGCTAATTGAAGTTATTCTTTCTTCCCATAG		splice_acceptor intron	N/A	NP_001035197.1	Q9UHC1-1
	MLH3	NM_014381.3		c.4171-37_4171-1dupTCATATTGCTAATTGAAGTTATTCTTTCTTCCCATAG		splice_acceptor intron	N/A	NP_055196.2	Q9UHC1-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MLH3	ENST00000355774.7	TSL:5 MANE Select	c.4243-1_4243insTCATATTGCTAATTGAAGTTATTCTTTCTTCCCATAG		splice_acceptor intron	N/A	ENSP00000348020.2	Q9UHC1-1
	MLH3	ENST00000380968.6	TSL:1	c.4171-1_4171insTCATATTGCTAATTGAAGTTATTCTTTCTTCCCATAG		splice_acceptor intron	N/A	ENSP00000370355.3	Q9UHC1-2
	MLH3	ENST00000930871.1		c.4243-1_4243insTCATATTGCTAATTGAAGTTATTCTTTCTTCCCATAG		splice_acceptor intron	N/A	ENSP00000600930.1

Frequencies

GnomAD3 genomes AF: 0.00561 AC: 854 AN: 152106 Hom.: 6 Cov.: 33

Gnomad AFR AF: 0.0199

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00157

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.00287

GnomAD2 exomes AF: 0.00137 AC: 345 AN: 251442 AF XY: 0.000949

Gnomad AFR exome AF: 0.0184

Gnomad AMR exome AF: 0.00113

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000879

Gnomad OTH exome AF: 0.000651

GnomAD4 exome AF: 0.000470 AC: 687 AN: 1461254 Hom.: 5 Cov.: 33 AF XY: 0.000400 AC XY: 291 AN XY: 726938

African (AFR) AF: 0.0165 AC: 551 AN: 33356

American (AMR) AF: 0.00103 AC: 46 AN: 44702

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26116

East Asian (EAS) AF: 0.00 AC: 0 AN: 39670

South Asian (SAS) AF: 0.0000464 AC: 4 AN: 86244

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53332

Middle Eastern (MID) AF: 0.000520 AC: 3 AN: 5766

European-Non Finnish (NFE) AF: 0.00000720 AC: 8 AN: 1111702

Other (OTH) AF: 0.00124 AC: 75 AN: 60366

GnomAD4 genome AF: 0.00560 AC: 853 AN: 152224 Hom.: 6 Cov.: 33 AF XY: 0.00524 AC XY: 390 AN XY: 74438

African (AFR) AF: 0.0198 AC: 820 AN: 41472

American (AMR) AF: 0.00157 AC: 24 AN: 15306

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5184

South Asian (SAS) AF: 0.00 AC: 0 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10610

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0000441 AC: 3 AN: 68032

Other (OTH) AF: 0.00284 AC: 6 AN: 2112

Alfa AF: 0.000334 Hom.: 0

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not specified (2)
-	-	1	Colorectal cancer, hereditary nonpolyposis, type 7 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.5
Mutation Taster		=98/2	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs56393982; hg19: chr14-75483904;