rs56393982

Variant names:

• chr14-75017201-T-TCTATGGGAAGAAAGAATAACTTCAATTAGCAATATGA
• rs56393982
• NM_001040108.2:c.4243-37_4243-1dupTCATATTGCTAATTGAAGTTATTCTTTCTTCCCATAG

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 8P and 16B. PVS1 BP6_Very_Strong BS1 BS2

The NM_001040108.2(MLH3):​c.4243-37_4243-1dupTCATATTGCTAATTGAAGTTATTCTTTCTTCCCATAG variant causes a splice acceptor, intron change. The variant allele was found at a frequency of 0.000954 in 1,613,478 control chromosomes in the GnomAD database, including 11 homozygotes. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0056 (6 hom., cov: 33)
  • Exomes 𝑓: 0.00047 (5 hom.)
• Consequence: MLH3 NM_001040108.2 splice_acceptor, intron
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 5.46

Genes affected

MLH3 (HGNC:7128): (mutL homolog 3) This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease,
• BP6: Variant 14-75017201-T-TCTATGGGAAGAAAGAATAACTTCAATTAGCAATATGA is Benign according to our data. Variant chr14-75017201-T-TCTATGGGAAGAAAGAATAACTTCAATTAGCAATATGA is described in ClinVar as [Benign]. Clinvar id is 238249.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.0056 (853/152224) while in subpopulation AFR AF= 0.0198 (820/41472). AF 95% confidence interval is 0.0187. There are 6 homozygotes in gnomad4. There are 390 alleles in male gnomad4 subpopulation. Median coverage is 33. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 853 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MLH3	NM_001040108.2	c.4243-37_4243-1dupTCATATTGCTAATTGAAGTTATTCTTTCTTCCCATAG		splice_acceptor_variant, intron_variant	Intron 12 of 12	ENST00000355774.7	NP_001035197.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MLH3	ENST00000355774.7	c.4243-1_4243insTCATATTGCTAATTGAAGTTATTCTTTCTTCCCATAG		splice_acceptor_variant, intron_variant	Intron 12 of 12	5	NM_001040108.2	ENSP00000348020.2

Frequencies

GnomAD3 genomes AF: 0.00561 AC: 854 AN: 152106 Hom.: 6 Cov.: 33

Gnomad AFR AF: 0.0199

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00157

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.00287

GnomAD3 exomes AF: 0.00137 AC: 345 AN: 251442 Hom.: 3 AF XY: 0.000949 AC XY: 129 AN XY: 135900

Gnomad AFR exome AF: 0.0184

Gnomad AMR exome AF: 0.00113

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.0000653

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000879

Gnomad OTH exome AF: 0.000651

GnomAD4 exome AF: 0.000470 AC: 687 AN: 1461254 Hom.: 5 Cov.: 33 AF XY: 0.000400 AC XY: 291 AN XY: 726938

Gnomad4 AFR exome AF: 0.0165

Gnomad4 AMR exome AF: 0.00103

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000464

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000720

Gnomad4 OTH exome AF: 0.00124

GnomAD4 genome AF: 0.00560 AC: 853 AN: 152224 Hom.: 6 Cov.: 33 AF XY: 0.00524 AC XY: 390 AN XY: 74438

Gnomad4 AFR AF: 0.0198

Gnomad4 AMR AF: 0.00157

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000441

Gnomad4 OTH AF: 0.00284

Alfa AF: 0.000334 Hom.: 0

ClinVar

Significance: Benign

Submissions summary: Benign:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:2

Mar 04, 2025

Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Aug 25, 2020

Ambry Genetics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Colorectal cancer, hereditary nonpolyposis, type 7 Benign:1

Jan 23, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs56393982; hg19: chr14-75483904;