rs565544512
Variant summary
Our verdict is Benign. The variant received -11 ACMG points: 0P and 11B. BP3BP6_ModerateBS1BS2
The NM_001122630.2(CDKN1C):c.467_490delCTCCGGTCGCGGCTCCGGTCGCGG(p.Ala156_Ala163del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000224 in 981,980 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Consequence
NM_001122630.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Beckwith-Wiedemann syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
- IMAGe syndromeInheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, Illumina
- rhabdomyosarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- Beckwith-Wiedemann syndrome due to CDKN1C mutationInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- intrauterine growth restriction-short stature-early adult-onset diabetes syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Silver-Russell syndromeInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -11 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001122630.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDKN1C | MANE Select | c.467_490delCTCCGGTCGCGGCTCCGGTCGCGG | p.Ala156_Ala163del | disruptive_inframe_deletion | Exon 2 of 4 | NP_001116102.1 | P49918-2 | ||
| CDKN1C | c.500_523delCTCCGGTCGCGGCTCCGGTCGCGG | p.Ala167_Ala174del | disruptive_inframe_deletion | Exon 1 of 3 | NP_000067.1 | P49918-1 | |||
| CDKN1C | c.500_523delCTCCGGTCGCGGCTCCGGTCGCGG | p.Ala167_Ala174del | disruptive_inframe_deletion | Exon 1 of 3 | NP_001349403.1 | P49918-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDKN1C | TSL:1 MANE Select | c.467_490delCTCCGGTCGCGGCTCCGGTCGCGG | p.Ala156_Ala163del | disruptive_inframe_deletion | Exon 2 of 4 | ENSP00000411257.2 | P49918-2 | ||
| CDKN1C | TSL:1 | c.500_523delCTCCGGTCGCGGCTCCGGTCGCGG | p.Ala167_Ala174del | disruptive_inframe_deletion | Exon 1 of 3 | ENSP00000413720.3 | P49918-1 | ||
| CDKN1C | TSL:1 | c.500_523delCTCCGGTCGCGGCTCCGGTCGCGG | p.Ala167_Ala174del | disruptive_inframe_deletion | Exon 1 of 3 | ENSP00000411552.2 | P49918-1 |
Frequencies
GnomAD3 genomes AF: 0.0000220 AC: 3AN: 136442Hom.: 0 Cov.: 25 show subpopulations
GnomAD4 exome AF: 0.0000225 AC: 19AN: 845538Hom.: 0 AF XY: 0.0000173 AC XY: 7AN XY: 404056 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000220 AC: 3AN: 136442Hom.: 0 Cov.: 25 AF XY: 0.0000302 AC XY: 2AN XY: 66298 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at