rs565544512

Positions:

• chr11-2884966-ACCGCGACCGGAGCCGCGACCGGAG-A
• chr11-2884966-ACCGCGACCGGAGCCGCGACCGGAG-ACCGCGACCGGAG
• chr11-2884966-ACCGCGACCGGAGCCGCGACCGGAG-ACCGCGACCGGAGCCGCGACCGGAGCCGCGACCGGAG
• chr11-2884966-ACCGCGACCGGAGCCGCGACCGGAG-ACCGCGACCGGAGCCGCGACCGGAGCCGCGACCGGAGCCGCGACCGGAG

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The NM_001122630.2(CDKN1C):​c.467_490delCTCCGGTCGCGGCTCCGGTCGCGG​(p.Ala156_Ala163del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000224 in 981,980 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.000022 (0 hom., cov: 25)
  • Exomes 𝑓: 0.000022 (0 hom.)
• Consequence: CDKN1C NM_001122630.2 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.593

Genes affected

CDKN1C (HGNC:1786): (cyclin dependent kinase inhibitor 1C) This gene is imprinted, with preferential expression of the maternal allele. The encoded protein is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and Beckwith-Wiedemann syndorome, suggesting that this gene is a tumor suppressor candidate. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]

CDKN1C (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• BP6: Variant 11-2884966-ACCGCGACCGGAGCCGCGACCGGAG-A is Benign according to our data. Variant chr11-2884966-ACCGCGACCGGAGCCGCGACCGGAG-A is described in ClinVar as [Likely_benign]. Clinvar id is 454006.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAdExome4 at 19 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CDKN1C	NM_001122630.2	c.467_490delCTCCGGTCGCGGCTCCGGTCGCGG	p.Ala156_Ala163del	disruptive_inframe_deletion	2/4	ENST00000440480.8	NP_001116102.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CDKN1C	ENST00000440480.8	c.467_490delCTCCGGTCGCGGCTCCGGTCGCGG	p.Ala156_Ala163del	disruptive_inframe_deletion	2/4	1	NM_001122630.2	ENSP00000411257.2

Frequencies

GnomAD3 genomes AF: 0.0000220 AC: 3 AN: 136442 Hom.: 0 Cov.: 25

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000703

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000461

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000225 AC: 19 AN: 845538 Hom.: 0 AF XY: 0.0000173 AC XY: 7 AN XY: 404056

Gnomad4 AFR exome AF: 0.0000560

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000936

Gnomad4 SAS exome AF: 0.0000610

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000168

Gnomad4 OTH exome AF: 0.0000876

GnomAD4 genome AF: 0.0000220 AC: 3 AN: 136442 Hom.: 0 Cov.: 25 AF XY: 0.0000302 AC XY: 2 AN XY: 66298

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.0000703

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000461

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Beckwith-Wiedemann syndrome Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Dec 02, 2023

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs565544512; hg19: chr11-2906196;