rs569481249

Variant names:

• chr3-12583776-T-TTTGTTTGTTAGAGAAACAAGGCTGGCCC
• rs569481249
• NM_002880.4:c.*710_*737dupGGGCCAGCCTTGTTTCTCTAACAAACAA

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The NM_002880.4(RAF1):​c.*710_*737dupGGGCCAGCCTTGTTTCTCTAACAAACAA variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000728 in 233,644 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0010 (0 hom., cov: 33)
  • Exomes 𝑓: 0.00020 (0 hom.)
• Consequence: RAF1 NM_002880.4 3_prime_UTR
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: -0.603
• Publications: 0 publications found

Genes affected

RAF1 (HGNC:9829): (Raf-1 proto-oncogene, serine/threonine kinase) This gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2. [provided by RefSeq, Jul 2008]

MKRN2 (HGNC:7113): (makorin ring finger protein 2) This gene encodes a probable E3 ubiquitin ligase containing several zinc finger domains, that is a member of the makorin RING zinc-finger protein family. This gene overlaps the v-raf-1 murine leukemia viral oncogene homolog 1 (RAF1) gene in an antisense orientation and may have a co-regulatory function with RAF1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• BP6: Variant 3-12583776-T-TTTGTTTGTTAGAGAAACAAGGCTGGCCC is Benign according to our data. Variant chr3-12583776-T-TTTGTTTGTTAGAGAAACAAGGCTGGCCC is described in ClinVar as Likely_benign. ClinVar VariationId is 2653541.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAd4 at 154 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002880.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RAF1	NM_002880.4	MANE Select	c.*710_*737dupGGGCCAGCCTTGTTTCTCTAACAAACAA		3_prime_UTR	Exon 17 of 17	NP_002871.1	L7RRS6
	RAF1	NM_001354689.3		c.*710_*737dupGGGCCAGCCTTGTTTCTCTAACAAACAA		3_prime_UTR	Exon 18 of 18	NP_001341618.1	A0A0S2Z559
	RAF1	NM_001354690.3		c.*710_*737dupGGGCCAGCCTTGTTTCTCTAACAAACAA		3_prime_UTR	Exon 17 of 17	NP_001341619.1	P04049-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RAF1	ENST00000251849.9	TSL:1 MANE Select	c.*710_*737dupGGGCCAGCCTTGTTTCTCTAACAAACAA		3_prime_UTR	Exon 17 of 17	ENSP00000251849.4	P04049-1
	RAF1	ENST00000442415.7	TSL:5	c.*710_*737dupGGGCCAGCCTTGTTTCTCTAACAAACAA		3_prime_UTR	Exon 18 of 18	ENSP00000401888.2	P04049-2
	RAF1	ENST00000900382.1		c.*710_*737dupGGGCCAGCCTTGTTTCTCTAACAAACAA		3_prime_UTR	Exon 18 of 18	ENSP00000570441.1

Frequencies

GnomAD3 genomes AF: 0.00102 AC: 155 AN: 152126 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00355

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000327

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00143

GnomAD4 exome AF: 0.000197 AC: 16 AN: 81396 Hom.: 0 Cov.: 0 AF XY: 0.0000267 AC XY: 1 AN XY: 37488

African (AFR) AF: 0.00283 AC: 11 AN: 3882

American (AMR) AF: 0.00 AC: 0 AN: 2504

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 5122

East Asian (EAS) AF: 0.00 AC: 0 AN: 11360

South Asian (SAS) AF: 0.00 AC: 0 AN: 704

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 424

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 492

European-Non Finnish (NFE) AF: 0.0000199 AC: 1 AN: 50132

Other (OTH) AF: 0.000590 AC: 4 AN: 6776

GnomAD4 genome AF: 0.00101 AC: 154 AN: 152248 Hom.: 0 Cov.: 33 AF XY: 0.000940 AC XY: 70 AN XY: 74470

African (AFR) AF: 0.00352 AC: 146 AN: 41494

American (AMR) AF: 0.000327 AC: 5 AN: 15304

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5186

South Asian (SAS) AF: 0.00 AC: 0 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10628

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68014

Other (OTH) AF: 0.00142 AC: 3 AN: 2114

Alfa AF: 0.000253 Hom.: 0

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.60

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs569481249; hg19: chr3-12625275;