rs587776874

Variant names:

• chr1-20652463-GTAGTAGGGGTAGGCCGAGGGGA-G
• rs587776874
• NM_005216.5:c.1214_1235delTCCCCTCGGCCTACCCCTACTA

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PP5_Moderate

The NM_005216.5(DDOST):​c.1214_1235delTCCCCTCGGCCTACCCCTACTA​(p.Ile405ThrfsTer7) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,648 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. I405I) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: DDOST NM_005216.5 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 9.96

Genes affected

DDOST (HGNC:2728): (dolichyl-diphosphooligosaccharide--protein glycosyltransferase non-catalytic subunit) This gene encodes a component of the oligosaccharyltransferase complex which catalyzes the transfer of high-mannose oligosaccharides to asparagine residues on nascent polypeptides in the lumen of the rough endoplasmic reticulum. The protein complex co-purifies with ribosomes. The product of this gene is also implicated in the processing of advanced glycation endproducts (AGEs), which form from non-enzymatic reactions between sugars and proteins or lipids and are associated with aging and hyperglycemia. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 1-20652463-GTAGTAGGGGTAGGCCGAGGGGA-G is Pathogenic according to our data. Variant chr1-20652463-GTAGTAGGGGTAGGCCGAGGGGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 30245.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr1-20652463-GTAGTAGGGGTAGGCCGAGGGGA-G is described in Lovd as [Likely_pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DDOST	NM_005216.5	c.1214_1235delTCCCCTCGGCCTACCCCTACTA	p.Ile405ThrfsTer7	frameshift_variant	Exon 11 of 11	ENST00000602624.7	NP_005207.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DDOST	ENST00000602624.7	c.1214_1235delTCCCCTCGGCCTACCCCTACTA	p.Ile405ThrfsTer7	frameshift_variant	Exon 11 of 11	1	NM_005216.5	ENSP00000473655.2
DDOST	ENST00000415136.6	c.1265_1286delTCCCCTCGGCCTACCCCTACTA	p.Ile422ThrfsTer7	frameshift_variant	Exon 11 of 11	1		ENSP00000399457.3
DDOST	ENST00000475210.1	n.*149_*170delTCCCCTCGGCCTACCCCTACTA		downstream_gene_variant		2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461648 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727114

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000224

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

Bravo AF: 0.00000378

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Congenital disorder of glycosylation type Ir Pathogenic:1

Feb 10, 2012

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

not provided Pathogenic:1

May 14, 2014

Eurofins Ntd Llc (ga)

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587776874; hg19: chr1-20978956;