rs587777239

Positions:

• chr11-533848-G-GGTCCCGCATGGCGCTGTACTC

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM1 PM2 PM4 PP5

The NM_005343.4(HRAS):​c.187_207dupGAGTACAGCGCCATGCGGGAC​(p.Asp69_Gln70insGluTyrSerAlaMetArgAsp) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: HRAS NM_005343.4 conservative_inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 0.853

Genes affected

HRAS (HGNC:5173): (HRas proto-oncogene, GTPase) This gene belongs to the Ras oncogene family, whose members are related to the transforming genes of mammalian sarcoma retroviruses. The products encoded by these genes function in signal transduction pathways. These proteins can bind GTP and GDP, and they have intrinsic GTPase activity. This protein undergoes a continuous cycle of de- and re-palmitoylation, which regulates its rapid exchange between the plasma membrane and the Golgi apparatus. Mutations in this gene cause Costello syndrome, a disease characterized by increased growth at the prenatal stage, growth deficiency at the postnatal stage, predisposition to tumor formation, cognitive disability, skin and musculoskeletal abnormalities, distinctive facial appearance and cardiovascular abnormalities. Defects in this gene are implicated in a variety of cancers, including bladder cancer, follicular thyroid cancer, and oral squamous cell carcinoma. Multiple transcript variants, which encode different isoforms, have been identified for this gene. [provided by RefSeq, Jul 2008]

LRRC56 (HGNC:25430): (leucine rich repeat containing 56) Predicted to be involved in cell projection organization. Predicted to be located in cilium. Implicated in primary ciliary dyskinesia 39. [provided by Alliance of Genome Resources, Apr 2022]

HRAS (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PM1: In a chain GTPase HRas, N-terminally processed (size 184) in uniprot entity RASH_HUMAN there are 12 pathogenic changes around while only 2 benign (86%) in NM_005343.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_005343.4.
• PP5: Variant 11-533848-G-GGTCCCGCATGGCGCTGTACTC is Pathogenic according to our data. Variant chr11-533848-G-GGTCCCGCATGGCGCTGTACTC is described in ClinVar as [Pathogenic]. Clinvar id is 120223.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
HRAS	NM_005343.4	c.187_207dupGAGTACAGCGCCATGCGGGAC	p.Asp69_Gln70insGluTyrSerAlaMetArgAsp	conservative_inframe_insertion	3/6	ENST00000311189.8	NP_005334.1
HRAS	NM_176795.5	c.187_207dupGAGTACAGCGCCATGCGGGAC	p.Asp69_Gln70insGluTyrSerAlaMetArgAsp	conservative_inframe_insertion	3/6	ENST00000417302.7	NP_789765.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
HRAS	ENST00000311189.8	c.187_207dupGAGTACAGCGCCATGCGGGAC	p.Asp69_Gln70insGluTyrSerAlaMetArgAsp	conservative_inframe_insertion	3/6	1	NM_005343.4	ENSP00000309845.7
HRAS	ENST00000417302.7	c.187_207dupGAGTACAGCGCCATGCGGGAC	p.Asp69_Gln70insGluTyrSerAlaMetArgAsp	conservative_inframe_insertion	3/6	5	NM_176795.5	ENSP00000388246.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 34

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Costello syndrome Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Apr 15, 2013

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587777239; hg19: chr11-533848;