rs587777674

Variant names:

• chr2-219469370-ATGACACAGTGTACGTGTCTGGGAAGTTCCCCGGGAG-A
• rs587777674
• NM_005876.5:c.3709_3715+29delACACAGTGTACGTGTCTGGGAAGTTCCCCGGGAGTG

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_005876.5(SPEG):​c.3709_3715+29delACACAGTGTACGTGTCTGGGAAGTTCCCCGGGAGTG​(p.Gln1238ThrfsTer2021) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: SPEG NM_005876.5 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.32
• Publications: 2 publications found

Genes affected

SPEG (HGNC:16901): (striated muscle enriched protein kinase) This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Along with the desmin gene, expression of this gene may be controlled by the desmin locus control region. Mutations in this gene are associated with centronuclear myopathy 5. [provided by RefSeq, Jun 2016]

SPEG Gene-Disease associations (from GenCC):

• myopathy, centronuclear, 5

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), ClinGen
• autosomal recessive centronuclear myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-219469370-ATGACACAGTGTACGTGTCTGGGAAGTTCCCCGGGAG-A is Pathogenic according to our data. Variant chr2-219469370-ATGACACAGTGTACGTGTCTGGGAAGTTCCCCGGGAG-A is described in ClinVar as Pathogenic. ClinVar VariationId is 144079.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SPEG	NM_005876.5	c.3709_3715+29delACACAGTGTACGTGTCTGGGAAGTTCCCCGGGAGTG	p.Gln1238ThrfsTer2021	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 13 of 41	ENST00000312358.12	NP_005867.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SPEG	ENST00000312358.12	c.3707_3715+27delTGACACAGTGTACGTGTCTGGGAAGTTCCCCGGGAG	p.Met1236_Tyr1239delinsAsn	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 13 of 41	5	NM_005876.5	ENSP00000311684.7
SPEG	ENST00000485813.5	n.2950_2958+27delTGACACAGTGTACGTGTCTGGGAAGTTCCCCGGGAG		splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	Exon 11 of 39	5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Myopathy, centronuclear, 5 Pathogenic:1

Aug 07, 2014

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=17/183	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587777674; hg19: chr2-220334092;