rs587779655

Variant names:

• chr2-188992187-GCTCGGGGTAATGACGGTGC-TTTACATCGAGGGTTTTAAAGTTTACA
• rs587779655
• NM_000090.4:c.955_974delGCTCGGGGTAATGACGGTGCinsTTTACATCGAGGGTTTTAAAGTTTACA

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1 PM2 PP2 PP5

The NM_000090.4(COL3A1):​c.955_974delGCTCGGGGTAATGACGGTGCinsTTTACATCGAGGGTTTTAAAGTTTACA​(p.Ala319PhefsTer13) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: COL3A1 NM_000090.4 frameshift, missense
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.40
• Publications: 0 publications found

Genes affected

COL3A1 (HGNC:2201): (collagen type III alpha 1 chain) This gene encodes the pro-alpha1 chains of type III collagen, a fibrillar collagen that is found in extensible connective tissues such as skin, lung, uterus, intestine and the vascular system, frequently in association with type I collagen. Mutations in this gene are associated with Ehlers-Danlos syndrome type IV, and with aortic and arterial aneurysms. [provided by R. Dalgleish, Feb 2008]

COL3A1 Gene-Disease associations (from GenCC):

• autosomal dominant Ehlers-Danlos syndrome, vascular type

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, PanelApp Australia, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• Ehlers-Danlos syndrome, vascular type

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• polymicrogyria with or without vascular-type Ehlers-Danlos syndrome

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP2: Missense variant in the COL3A1 gene, where missense mutations are typically associated with disease (based on misZ statistic). The gene has 495 curated pathogenic missense variants (we use a threshold of 10). The gene has 19 curated benign missense variants. Gene score misZ: 4.0879 (above the threshold of 3.09). Trascript score misZ: 4.5995 (above the threshold of 3.09). GenCC associations: The gene is linked to Ehlers-Danlos syndrome, vascular type, polymicrogyria with or without vascular-type Ehlers-Danlos syndrome, autosomal dominant Ehlers-Danlos syndrome, vascular type.
• PP5: Variant 2-188992187-GCTCGGGGTAATGACGGTGC-TTTACATCGAGGGTTTTAAAGTTTACA is Pathogenic according to our data. Variant chr2-188992187-GCTCGGGGTAATGACGGTGC-TTTACATCGAGGGTTTTAAAGTTTACA is described in ClinVar as Pathogenic. ClinVar VariationId is 101398.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000090.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL3A1	NM_000090.4	MANE Select	c.955_974delGCTCGGGGTAATGACGGTGCinsTTTACATCGAGGGTTTTAAAGTTTACA	p.Ala319PhefsTer13	frameshift missense	Exon 14 of 51	NP_000081.2	P02461-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL3A1	ENST00000304636.9	TSL:1 MANE Select	c.955_974delGCTCGGGGTAATGACGGTGCinsTTTACATCGAGGGTTTTAAAGTTTACA	p.Ala319PhefsTer13	frameshift missense	Exon 14 of 51	ENSP00000304408.4	P02461-1
	COL3A1	ENST00000450867.2	TSL:1	c.955_974delGCTCGGGGTAATGACGGTGCinsTTTACATCGAGGGTTTTAAAGTTTACA	p.Ala319PhefsTer13	frameshift missense	Exon 14 of 50	ENSP00000415346.2	H7C435
	COL3A1	ENST00000879201.1		c.946_965delGCTCGGGGTAATGACGGTGCinsTTTACATCGAGGGTTTTAAAGTTTACA	p.Ala316PhefsTer13	frameshift missense	Exon 14 of 51	ENSP00000549260.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Ehlers-Danlos syndrome, type 4 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587779655; hg19: chr2-189856913;