rs587779859

Variant names:

• chr11-108327633-TTTCTTATACAGAACAATCCCAGCC-T
• rs587779859
• NM_000051.4:c.6976-10_6989delTCTTATACAGAACAATCCCAGCCT

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000051.4(ATM):​c.6976-10_6989delTCTTATACAGAACAATCCCAGCCT​(p.Asn2326fs) variant causes a frameshift, splice acceptor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. N2326N) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ATM NM_000051.4 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 4.97

Genes affected

ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]

C11orf65 (HGNC:28519): (chromosome 11 open reading frame 65) Predicted to be involved in negative regulation of mitochondrial fission and negative regulation of protein targeting to mitochondrion. Predicted to be located in cytosol and mitochondrial outer membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-108327633-TTTCTTATACAGAACAATCCCAGCC-T is Pathogenic according to our data. Variant chr11-108327633-TTTCTTATACAGAACAATCCCAGCC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 127432.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATM	NM_000051.4	c.6976-10_6989delTCTTATACAGAACAATCCCAGCCT	p.Asn2326fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 48 of 63	ENST00000675843.1	NP_000042.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATM	ENST00000675843.1	c.6976-10_6989delTCTTATACAGAACAATCCCAGCCT	p.Asn2326fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 48 of 63		NM_000051.4	ENSP00000501606.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:6

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:3

Aug 13, 2019

Color Diagnostics, LLC DBA Color Health

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant deletes 24 nucleotides encompassing the last 10 nucleotides of intron 47 and the first 14 nucleotides of exon 48 of the ATM gene. This variant is expected to disrupt the intron 47 splice acceptor site. Although RNA study has not been performed to confirm the prediction, this variant is expected to result in an absent or disrupted protein product. To our knowledge, functional assays have not been performed for this variant nor has this variant been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of ATM function is a known mechanism of disease. Based on available evidence, this variant is classified as Likely Pathogenic. -

Jun 20, 2014

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is denoted ATM c.6976-10_6989del24 and consists of a deletion of 24 nucleotides at the -10 position of intron 47. The surrounding sequence and deleted bases are cctt{tcttatacagAACAATCCCAGCCT}AAAAC, where the lower case letters are intronic bases and upper case exonic. The deletion spans the intron-exon boundary, resulting in loss of the canonical splice acceptor site. It is predicted to cause abnormal gene splicing, leading to either an abnormal message that is subject to nonsense-mediated mRNA decay or to an abnormal protein product. Although the mutation has not, to our knowledge, been published in the literature, it is considered pathogenic. One mutation in the ATM gene has been estimated to increase the relative risk of female breast cancer about 2-fold over the general population (Thompson 2005, Renwick 2006) resulting in a lifetime risk of approximately 25-30%. According to one study, breast cancer risk in women under age 50 who carry one ATM mutation is nearly 5 times the age-matched general population risk which translates to approximately a 10% risk (Thompson 2005). This study of 1160 ATM carriers also reported evidence of increased risk for colon cancer. In a recent study of 166 unrelated familial pancreatic cancer patients, 2.4% were identified as carriers of one ATM mutation, and in families with 3 or more cases of pancreatic cancer, 4.6% carried an ATM mutation (Roberts 2012). Ataxia-telangiectasia (A-T) is an autosomal recessive condition caused by two mutations (one affecting each allele) in the ATM gene. This multisystem disorder is characterized by progressive neurodegeneration, telangiectasias, immunodeficiency, and increased cancer risks. If an ATM mutation carrier's partner is also heterozygous for an ATM mutation, the risk to have a child with A-T is 25% with each pregnancy. The variant is found in PANC-HEREDIC,BR-OV-HEREDIC panel(s). -

Jul 03, 2024

Ambry Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.6976-10_6989del24 variant results from a deletion of 24 nucleotides between positions c.6976-10 and c.6989 and involves the canonical splice acceptor site before coding exon 47 of the ATM gene. This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). The canonical splice acceptor site is highly conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will weaken the native splice acceptor site. RNA studies have demonstrated that this alteration results in abnormal splicing in the set of samples tested (Ambry internal data). Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as likely pathogenic. -

Familial cancer of breast Pathogenic:2

Mar 04, 2024

Baylor Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jan 30, 2024

Myriad Genetics, Inc.

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -

Ataxia-telangiectasia syndrome Pathogenic:1

Mar 31, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant has not been reported in the literature in individuals with ATM-related conditions. ClinVar contains an entry for this variant (Variation ID: 127432). This sequence change affects an acceptor splice site in intron 48 of the ATM gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in ATM are known to be pathogenic (PMID: 23807571, 25614872). This variant is not present in population databases (ExAC no frequency). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587779859; hg19: chr11-108198360;