rs587780487

Variant names:

• chr2-178677741-TTTCCTCTTCTTCAGGTAGAAC-T
• rs587780487
• NM_001267550.2:c.34150_34170delGTTCTACCTGAAGAAGAGGAA

Your query was ambiguous. Multiple possible variants found:

• chr2-178677741-TTTCCTCTTCTTCAGGTAGAAC-T
• chr2-178677741-TTTCCTCTTCTTCAGGTAGAAC-TTTCCTCTTCTTCAGGTAGAACTTCCTCTTCTTCAGGTAGAAC

Variant summary

Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PM4 BP6 BS1

The NM_001267550.2(TTN):​c.34150_34170delGTTCTACCTGAAGAAGAGGAA​(p.Val11384_Glu11390del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.000725 in 151,708 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00073 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0014 (9 hom.)
  • Failed GnomAD Quality Control
• Consequence: TTN NM_001267550.2 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:9
• Conservation: PhyloP100: 6.13
• Publications: 1 publications found

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

LOC124906100 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001267550.2.
• BP6: Variant 2-178677741-TTTCCTCTTCTTCAGGTAGAAC-T is Benign according to our data. Variant chr2-178677741-TTTCCTCTTCTTCAGGTAGAAC-T is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 130665.
• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.000725 (110/151708) while in subpopulation SAS AF = 0.00334 (16/4796). AF 95% confidence interval is 0.00209. There are 0 homozygotes in GnomAd4. There are 52 alleles in the male GnomAd4 subpopulation. Median coverage is 31. This position passed quality control check.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001267550.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	NM_001267550.2	MANE Select	c.34150_34170delGTTCTACCTGAAGAAGAGGAA	p.Val11384_Glu11390del	conservative_inframe_deletion	Exon 146 of 363	NP_001254479.2	Q8WZ42-12
	TTN	NM_001256850.1		c.33199_33219delGTTCTACCTGAAGAAGAGGAA	p.Val11067_Glu11073del	conservative_inframe_deletion	Exon 144 of 313	NP_001243779.1	Q8WZ42-1
	TTN	NM_133378.4		c.30418_30438delGTTCTACCTGAAGAAGAGGAA	p.Val10140_Glu10146del	conservative_inframe_deletion	Exon 143 of 312	NP_596869.4	Q8WZ42-11

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	ENST00000589042.5	TSL:5 MANE Select	c.34150_34170delGTTCTACCTGAAGAAGAGGAA	p.Val11384_Glu11390del	conservative_inframe_deletion	Exon 146 of 363	ENSP00000467141.1	Q8WZ42-12
	TTN	ENST00000446966.2	TSL:1	c.34150_34170delGTTCTACCTGAAGAAGAGGAA	p.Val11384_Glu11390del	conservative_inframe_deletion	Exon 146 of 361	ENSP00000408004.2	A0A1B0GXE3
	TTN	ENST00000436599.2	TSL:1	c.33874_33894delGTTCTACCTGAAGAAGAGGAA	p.Val11292_Glu11298del	conservative_inframe_deletion	Exon 144 of 361	ENSP00000405517.2	A0A0C4DG59

Frequencies

GnomAD3 genomes AF: 0.000732 AC: 111 AN: 151590 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.000266

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000593

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00136

Gnomad SAS AF: 0.00354

Gnomad FIN AF: 0.0000944

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000959

Gnomad OTH AF: 0.000479

GnomAD2 exomes AF: 0.00133 AC: 330 AN: 248956 AF XY: 0.00163

Gnomad AFR exome AF: 0.000259

Gnomad AMR exome AF: 0.000609

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00117

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000904

Gnomad OTH exome AF: 0.00149

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00135 AC: 1979 AN: 1460714 Hom.: 9 AF XY: 0.00151 AC XY: 1098 AN XY: 726634

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000509 AC: 17 AN: 33414

American (AMR) AF: 0.000492 AC: 22 AN: 44700

Ashkenazi Jewish (ASJ) AF: 0.0000766 AC: 2 AN: 26098

East Asian (EAS) AF: 0.000731 AC: 29 AN: 39680

South Asian (SAS) AF: 0.00456 AC: 393 AN: 86136

European-Finnish (FIN) AF: 0.0000375 AC: 2 AN: 53396

Middle Eastern (MID) AF: 0.00104 AC: 6 AN: 5762

European-Non Finnish (NFE) AF: 0.00128 AC: 1420 AN: 1111196

Other (OTH) AF: 0.00146 AC: 88 AN: 60332

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000725 AC: 110 AN: 151708 Hom.: 0 Cov.: 31 AF XY: 0.000701 AC XY: 52 AN XY: 74160

African (AFR) AF: 0.000266 AC: 11 AN: 41426

American (AMR) AF: 0.000592 AC: 9 AN: 15192

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3464

East Asian (EAS) AF: 0.00136 AC: 7 AN: 5134

South Asian (SAS) AF: 0.00334 AC: 16 AN: 4796

European-Finnish (FIN) AF: 0.0000944 AC: 1 AN: 10592

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.000959 AC: 65 AN: 67790

Other (OTH) AF: 0.000474 AC: 1 AN: 2110

Alfa AF: 0.000395 Hom.: 0

EpiCase AF: 0.000764

EpiControl AF: 0.00107

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	-	4	not specified (4)
-	1	2	not provided (3)
-	-	1	Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G (1)
-	-	1	Cardiomyopathy (1)
-	1	-	Hypertrophic cardiomyopathy (1)
-	-	1	TTN-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.1
Mutation Taster		=186/14	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587780487; hg19: chr2-179542468;