rs587780668

Variant names:

• chr9-21974795-AGGCTCCATGCTGCTCCCCGCCGCC-A
• rs587780668
• NM_000077.5:c.9_32delGGCGGCGGGGAGCAGCATGGAGCC

Your query was ambiguous. Multiple possible variants found:

• chr9-21974795-AGGCTCCATGCTGCTCCCCGCCGCC-A
• chr9-21974795-AGGCTCCATGCTGCTCCCCGCCGCC-AGGCTCCATGCTGCTCCCCGCCGCCGGCTCCATGCTGCTCCCCGCCGCC

Variant summary

Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PM4 BS1_Supporting BS2

The NM_000077.5(CDKN2A):​c.9_32delGGCGGCGGGGAGCAGCATGGAGCC​(p.Ala4_Pro11del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000952 in 1,606,464 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. P3P) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.00024 (1 hom., cov: 32)
  • Exomes 𝑓: 0.000080 (0 hom.)
• Consequence: CDKN2A NM_000077.5 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:11 B:2
• Conservation: PhyloP100: 2.62
• Publications: 5 publications found

Genes affected

CDKN2A (HGNC:1787): (cyclin dependent kinase inhibitor 2A) This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012]

CDKN2A Gene-Disease associations (from GenCC):

• melanoma, cutaneous malignant, susceptibility to, 2

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• melanoma-pancreatic cancer syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics, Genomics England PanelApp
• familial atypical multiple mole melanoma syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• melanoma and neural system tumor syndrome

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ENSG00000264545 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000077.5.
• BS1: Variant frequency is greater than expected in population amr. GnomAd4 allele frequency = 0.000243 (37/151972) while in subpopulation AMR AF = 0.0021 (32/15266). AF 95% confidence interval is 0.00153. There are 1 homozygotes in GnomAd4. There are 28 alleles in the male GnomAd4 subpopulation. Median coverage is 32. This position passed quality control check. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting
• BS2: High AC in GnomAd4 at 37 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000077.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CDKN2A	NM_000077.5	MANE Select	c.9_32delGGCGGCGGGGAGCAGCATGGAGCC	p.Ala4_Pro11del	disruptive_inframe_deletion	Exon 1 of 3	NP_000068.1	P42771-1
	CDKN2A	NM_058195.4	MANE Plus Clinical	c.194-3611_194-3588delGGCGGCGGGGAGCAGCATGGAGCC		intron	N/A	NP_478102.2	Q8N726-1
	CDKN2A	NM_001195132.2		c.9_32delGGCGGCGGGGAGCAGCATGGAGCC	p.Ala4_Pro11del	disruptive_inframe_deletion	Exon 1 of 4	NP_001182061.1	P42771-4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CDKN2A	ENST00000304494.10	TSL:1 MANE Select	c.9_32delGGCGGCGGGGAGCAGCATGGAGCC	p.Ala4_Pro11del	disruptive_inframe_deletion	Exon 1 of 3	ENSP00000307101.5	P42771-1
	CDKN2A	ENST00000498124.1	TSL:1	c.9_32delGGCGGCGGGGAGCAGCATGGAGCC	p.Ala4_Pro11del	disruptive_inframe_deletion	Exon 1 of 4	ENSP00000418915.1	P42771-4
	CDKN2A	ENST00000579755.2	TSL:1 MANE Plus Clinical	c.194-3611_194-3588delGGCGGCGGGGAGCAGCATGGAGCC		intron	N/A	ENSP00000462950.1	Q8N726-1

Frequencies

GnomAD3 genomes AF: 0.000243 AC: 37 AN: 151972 Hom.: 1 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00210

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000589

Gnomad OTH AF: 0.000478

GnomAD2 exomes AF: 0.000145 AC: 34 AN: 233942 AF XY: 0.000132

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000525

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000112

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000958

Gnomad OTH exome AF: 0.000342

GnomAD4 exome AF: 0.0000798 AC: 116 AN: 1454492 Hom.: 0 AF XY: 0.0000760 AC XY: 55 AN XY: 723908

African (AFR) AF: 0.00 AC: 0 AN: 33442

American (AMR) AF: 0.000493 AC: 22 AN: 44622

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26028

East Asian (EAS) AF: 0.000101 AC: 4 AN: 39678

South Asian (SAS) AF: 0.0000581 AC: 5 AN: 86120

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 47540

Middle Eastern (MID) AF: 0.000175 AC: 1 AN: 5708

European-Non Finnish (NFE) AF: 0.0000720 AC: 80 AN: 1111106

Other (OTH) AF: 0.0000664 AC: 4 AN: 60248

GnomAD4 genome AF: 0.000243 AC: 37 AN: 151972 Hom.: 1 Cov.: 32 AF XY: 0.000377 AC XY: 28 AN XY: 74232

African (AFR) AF: 0.00 AC: 0 AN: 41378

American (AMR) AF: 0.00210 AC: 32 AN: 15266

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5158

South Asian (SAS) AF: 0.00 AC: 0 AN: 4820

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10612

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.0000589 AC: 4 AN: 67948

Other (OTH) AF: 0.000478 AC: 1 AN: 2094

Alfa AF: 0.000130 Hom.: 0

Bravo AF: 0.000155

EpiCase AF: 0.000109

EpiControl AF: 0.00

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	3	-	Melanoma-pancreatic cancer syndrome (3)
-	2	-	Familial melanoma (2)
-	1	1	Hereditary cancer-predisposing syndrome (2)
-	2	-	not provided (2)
-	1	1	not specified (2)
-	1	-	Melanoma and neural system tumor syndrome (1)
-	1	-	Melanoma and neural system tumor syndrome;C1835044:Melanoma, cutaneous malignant, susceptibility to, 2;C1838547:Melanoma-pancreatic cancer syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.6
Mutation Taster		=1/199	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587780668; hg19: chr9-21974794; COSMIC: COSV58687620;