rs587781442
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_005591.4(MRE11):c.1960_1979dupGACATTTTTCCTACCACTTC(p.Lys661ThrfsTer45) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000591 in 152,234 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_005591.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- ataxia-telangiectasia-like disorder 1Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Orphanet, Ambry Genetics
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- familial ovarian cancerInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- prostate cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MRE11 | NM_005591.4 | c.1960_1979dupGACATTTTTCCTACCACTTC | p.Lys661ThrfsTer45 | frameshift_variant | Exon 18 of 20 | ENST00000323929.8 | NP_005582.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MRE11 | ENST00000323929.8 | c.1960_1979dupGACATTTTTCCTACCACTTC | p.Lys661ThrfsTer45 | frameshift_variant | Exon 18 of 20 | 1 | NM_005591.4 | ENSP00000325863.4 | ||
| MRE11 | ENST00000323977.7 | c.1876_1895dupGACATTTTTCCTACCACTTC | p.Lys633ThrfsTer45 | frameshift_variant | Exon 17 of 19 | 1 | ENSP00000326094.3 | |||
| MRE11 | ENST00000407439.7 | c.1969_1988dupGACATTTTTCCTACCACTTC | p.Lys664ThrfsTer45 | frameshift_variant | Exon 18 of 20 | 2 | ENSP00000385614.3 | |||
| MRE11 | ENST00000393241.8 | c.1957_1976dupGACATTTTTCCTACCACTTC | p.Lys660ThrfsTer45 | frameshift_variant | Exon 18 of 20 | 5 | ENSP00000376933.4 |
Frequencies
GnomAD3 genomes AF: 0.0000591 AC: 9AN: 152234Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000205 AC: 3AN: 1461298Hom.: 0 Cov.: 30 AF XY: 0.00000138 AC XY: 1AN XY: 727000 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000591 AC: 9AN: 152234Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1AN XY: 74386 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
Ataxia-telangiectasia-like disorder 1 Pathogenic:3
- -
- -
- -
not provided Uncertain:3
Frameshift variant predicted to result in protein truncation as the last 55 amino acids are replaced with 44 different amino acids, although loss-of-function variants have not been reported downstream of this position in the protein; Observed in a patient in the published literature, but no additional information was provided (LaDuca et al., 2017); This variant is associated with the following publications: (PMID: 27535533, 28152038) -
- -
Available data are insufficient to determine the clinical significance of the variant at this time. The frequency of this variant in the general population is uninformative in assessment of its pathogenicity. (http://gnomad.broadinstitute.org) This variant is not expected to cause loss of protein expression through nonsense-mediated decay. However, it may still disrupt protein function. This variant has been identified in at least one individual with clinical features associated with this gene. -
Hereditary cancer-predisposing syndrome Pathogenic:1
The c.1960_1979dup20 variant, located in coding exon 17 of the MRE11A gene, results from a duplication of GACATTTTTCCTACCACTTC at nucleotide position 1960, causing a translational frameshift with a predicted alternate stop codon (p.K661Tfs*45). This alteration is expected to result in loss of function by premature protein truncation. Based on the majority of available evidence to date, this variant is likely to be pathogenic. -
Ataxia-telangiectasia-like disorder Uncertain:1
This sequence change creates a premature translational stop signal (p.Lys661Thrfs*45) in the MRE11 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 48 amino acid(s) of the MRE11 protein. This variant is present in population databases (rs587781442, gnomAD 0.02%). This premature translational stop signal has been observed in individual(s) with ataxia-telangiectasia-like disorder (PMID: 33426167). This variant is also known as c.1876_1895dup; p.Lys633fs. ClinVar contains an entry for this variant (Variation ID: 141025). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at