rs587781442

Variant names:

• chr11-94435846-T-TGAAGTGGTAGGAAAAATGTC
• rs587781442
• NM_005591.4:c.1960_1979dupGACATTTTTCCTACCACTTC

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_005591.4(MRE11):​c.1960_1979dupGACATTTTTCCTACCACTTC​(p.Lys661ThrfsTer45) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000591 in 152,234 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000059 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MRE11 NM_005591.4 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:4 U:4
• Conservation: PhyloP100: 2.08
• Publications: 4 publications found

Genes affected

MRE11 (HGNC:7230): (MRE11 homolog, double strand break repair nuclease) This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

MRE11 Gene-Disease associations (from GenCC):

• ataxia-telangiectasia-like disorder 1

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Orphanet
• breast cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
• familial ovarian cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• prostate cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 11-94435846-T-TGAAGTGGTAGGAAAAATGTC is Pathogenic according to our data. Variant chr11-94435846-T-TGAAGTGGTAGGAAAAATGTC is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 141025.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005591.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MRE11	NM_005591.4	MANE Select	c.1960_1979dupGACATTTTTCCTACCACTTC	p.Lys661ThrfsTer45	frameshift	Exon 18 of 20	NP_005582.1	P49959-1
	MRE11	NM_001440460.1		c.1960_1979dupGACATTTTTCCTACCACTTC	p.Lys661ThrfsTer62	frameshift	Exon 18 of 21	NP_001427389.1
	MRE11	NM_001440461.1		c.1960_1979dupGACATTTTTCCTACCACTTC	p.Lys661ThrfsTer62	frameshift	Exon 18 of 21	NP_001427390.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MRE11	ENST00000323929.8	TSL:1 MANE Select	c.1960_1979dupGACATTTTTCCTACCACTTC	p.Lys661ThrfsTer45	frameshift	Exon 18 of 20	ENSP00000325863.4	P49959-1
	MRE11	ENST00000323977.7	TSL:1	c.1876_1895dupGACATTTTTCCTACCACTTC	p.Lys633ThrfsTer45	frameshift	Exon 17 of 19	ENSP00000326094.3	P49959-2
	MRE11	ENST00000936196.1		c.1960_1979dupGACATTTTTCCTACCACTTC	p.Lys661ThrfsTer62	frameshift	Exon 18 of 21	ENSP00000606255.1

Frequencies

GnomAD3 genomes AF: 0.0000591 AC: 9 AN: 152234 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000217

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000205 AC: 3 AN: 1461298 Hom.: 0 Cov.: 30 AF XY: 0.00000138 AC XY: 1 AN XY: 727000

African (AFR) AF: 0.0000598 AC: 2 AN: 33462

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26130

East Asian (EAS) AF: 0.00 AC: 0 AN: 39674

South Asian (SAS) AF: 0.00 AC: 0 AN: 86242

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53252

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111668

Other (OTH) AF: 0.0000166 AC: 1 AN: 60380

GnomAD4 genome AF: 0.0000591 AC: 9 AN: 152234 Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1 AN XY: 74386

African (AFR) AF: 0.000217 AC: 9 AN: 41452

American (AMR) AF: 0.00 AC: 0 AN: 15286

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5204

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10628

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68042

Other (OTH) AF: 0.00 AC: 0 AN: 2092

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
3	-	-	Ataxia-telangiectasia-like disorder 1 (3)
-	3	-	not provided (3)
-	1	-	Ataxia-telangiectasia-like disorder (1)
1	-	-	Hereditary cancer-predisposing syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587781442; hg19: chr11-94169012;