rs587781442
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_005591.4(MRE11):c.1960_1979dupGACATTTTTCCTACCACTTC(p.Lys661ThrfsTer45) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000591 in 152,234 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_005591.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- ataxia-telangiectasia-like disorder 1Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Orphanet
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- familial ovarian cancerInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- prostate cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005591.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MRE11 | MANE Select | c.1960_1979dupGACATTTTTCCTACCACTTC | p.Lys661ThrfsTer45 | frameshift | Exon 18 of 20 | NP_005582.1 | P49959-1 | ||
| MRE11 | c.1960_1979dupGACATTTTTCCTACCACTTC | p.Lys661ThrfsTer62 | frameshift | Exon 18 of 21 | NP_001427389.1 | ||||
| MRE11 | c.1960_1979dupGACATTTTTCCTACCACTTC | p.Lys661ThrfsTer62 | frameshift | Exon 18 of 21 | NP_001427390.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MRE11 | TSL:1 MANE Select | c.1960_1979dupGACATTTTTCCTACCACTTC | p.Lys661ThrfsTer45 | frameshift | Exon 18 of 20 | ENSP00000325863.4 | P49959-1 | ||
| MRE11 | TSL:1 | c.1876_1895dupGACATTTTTCCTACCACTTC | p.Lys633ThrfsTer45 | frameshift | Exon 17 of 19 | ENSP00000326094.3 | P49959-2 | ||
| MRE11 | c.1960_1979dupGACATTTTTCCTACCACTTC | p.Lys661ThrfsTer62 | frameshift | Exon 18 of 21 | ENSP00000606255.1 |
Frequencies
GnomAD3 genomes AF: 0.0000591 AC: 9AN: 152234Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000205 AC: 3AN: 1461298Hom.: 0 Cov.: 30 AF XY: 0.00000138 AC XY: 1AN XY: 727000 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000591 AC: 9AN: 152234Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1AN XY: 74386 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at