rs587783707

Positions:

• chr12-49051400-TAGGTGTGGCTCCTCAGGCCGGGGGGAC-T

Variant summary

Our verdict is Likely benign. Variant got -3 ACMG points: 2P and 5B. PM4 BP6 BS2

The NM_003482.4(KMT2D):​c.2256_2282delGTCCCCCCGGCCTGAGGAGCCACACCT​(p.Ser753_Leu761del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000103 in 1,442,462 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00016 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000099 (0 hom.)
• Consequence: KMT2D NM_003482.4 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:3
• Conservation: PhyloP100: 1.36

Genes affected

KMT2D (HGNC:7133): (lysine methyltransferase 2D) The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]

ACMG classification

Verdict is Likely_benign. Variant got -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_003482.4.
• BP6: Variant 12-49051400-TAGGTGTGGCTCCTCAGGCCGGGGGGAC-T is Benign according to our data. Variant chr12-49051400-TAGGTGTGGCTCCTCAGGCCGGGGGGAC-T is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 158753.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=3, Uncertain_significance=1}. Variant chr12-49051400-TAGGTGTGGCTCCTCAGGCCGGGGGGAC-T is described in Lovd as [Likely_benign].
• BS2: High AC in GnomAd4 at 15 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
KMT2D	NM_003482.4	c.2256_2282delGTCCCCCCGGCCTGAGGAGCCACACCT	p.Ser753_Leu761del	disruptive_inframe_deletion	11/55	ENST00000301067.12	NP_003473.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
KMT2D	ENST00000301067.12	c.2256_2282delGTCCCCCCGGCCTGAGGAGCCACACCT	p.Ser753_Leu761del	disruptive_inframe_deletion	11/55	5	NM_003482.4	ENSP00000301067.7
KMT2D	ENST00000683543.2	c.2256_2282delGTCCCCCCGGCCTGAGGAGCCACACCT	p.Ser753_Leu761del	disruptive_inframe_deletion	11/56			ENSP00000506726.1
KMT2D	ENST00000685166.1	c.2256_2282delGTCCCCCCGGCCTGAGGAGCCACACCT	p.Ser753_Leu761del	disruptive_inframe_deletion	10/54			ENSP00000509386.1
KMT2D	ENST00000692637.1	c.2256_2282delGTCCCCCCGGCCTGAGGAGCCACACCT	p.Ser753_Leu761del	disruptive_inframe_deletion	10/54			ENSP00000509666.1

Frequencies

GnomAD3 genomes AF: 0.000161 AC: 15 AN: 92980 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000424

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000963

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000172

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000273

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000544 AC: 13 AN: 239170 Hom.: 0 AF XY: 0.0000534 AC XY: 7 AN XY: 130984

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000298

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.000133

Gnomad FIN exome AF: 0.000187

Gnomad NFE exome AF: 0.0000280

Gnomad OTH exome AF: 0.000172

GnomAD4 exome AF: 0.0000986 AC: 133 AN: 1349482 Hom.: 0 AF XY: 0.000112 AC XY: 75 AN XY: 672366

Gnomad4 AFR exome AF: 0.0000347

Gnomad4 AMR exome AF: 0.0000797

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000725

Gnomad4 FIN exome AF: 0.000169

Gnomad4 NFE exome AF: 0.000106

Gnomad4 OTH exome AF: 0.0000761

GnomAD4 genome AF: 0.000161 AC: 15 AN: 92980 Hom.: 0 Cov.: 31 AF XY: 0.000129 AC XY: 6 AN XY: 46342

Gnomad4 AFR AF: 0.0000424

Gnomad4 AMR AF: 0.0000963

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000172

Gnomad4 NFE AF: 0.000273

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000122 Hom.: 0

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:1 Benign:3

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:1 Benign:1

Likely benign, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	Sep 01, 2022	KMT2D: BS2 -
Uncertain significance, criteria provided, single submitter	clinical testing	GeneDx	Aug 24, 2023	See Variant Classification Assertion Criteria. -

not specified Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Genetic Services Laboratory, University of Chicago

Feb 08, 2013

- -

Kabuki syndrome Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 06, 2024

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587783707; hg19: chr12-49445183;