rs60538473

Variant names:

• chr2-219418976-CAGCGCGCGCGCGTCGACGTCG-C
• rs60538473
• NM_001927.4:c.521_541delCGCGCGTCGACGTCGAGCGCG

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP3 PP5

The NM_001927.4(DES):​c.521_541delCGCGCGTCGACGTCGAGCGCG​(p.Ala174_Arg180del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. A174A) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: DES NM_001927.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1 O:2
• Conservation: PhyloP100: 9.72
• Publications: 2 publications found

Genes affected

DES (HGNC:2770): (desmin) This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane. Mutations in this gene are associated with desmin-related myopathy, a familial cardiac and skeletal myopathy (CSM), and with distal myopathies. [provided by RefSeq, Jul 2008]

DES Gene-Disease associations (from GenCC):

• dilated cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• dilated cardiomyopathy 1I

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• myofibrillar myopathy 1

  Inheritance: AD, AR, SD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• atrioventricular block

  Inheritance: AD, AR Classification: STRONG Submitted by: Genomics England PanelApp
• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: MODERATE Submitted by: ClinGen
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• neurogenic scapuloperoneal syndrome, Kaeser type

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001927.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 2-219418976-CAGCGCGCGCGCGTCGACGTCG-C is Pathogenic according to our data. Variant chr2-219418976-CAGCGCGCGCGCGTCGACGTCG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 16823.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DES	NM_001927.4	c.521_541delCGCGCGTCGACGTCGAGCGCG	p.Ala174_Arg180del	disruptive_inframe_deletion	Exon 1 of 9	ENST00000373960.4	NP_001918.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DES	ENST00000373960.4	c.521_541delCGCGCGTCGACGTCGAGCGCG	p.Ala174_Arg180del	disruptive_inframe_deletion	Exon 1 of 9	1	NM_001927.4	ENSP00000363071.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1 Other:2

Revision: no assertion criteria provided

Submissions by phenotype

Desmin-related myofibrillar myopathy Pathogenic:1 Other:1

-

GeneReviews

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Jun 01, 2009

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

not provided Other:1

-

Epithelial Biology; Institute of Medical Biology, Singapore

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.7
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60538473; hg19: chr2-220283698;