rs60538473

Variant names:

• chr2-219418976-CAGCGCGCGCGCGTCGACGTCG-C
• rs60538473
• NM_001927.4:c.521_541delCGCGCGTCGACGTCGAGCGCG

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP3 PP5

The NM_001927.4(DES):​c.521_541delCGCGCGTCGACGTCGAGCGCG​(p.Ala174_Arg180del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. A174A) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: DES NM_001927.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1 O:2
• Conservation: PhyloP100: 9.72
• Publications: 2 publications found

Genes affected

DES (HGNC:2770): (desmin) This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane. Mutations in this gene are associated with desmin-related myopathy, a familial cardiac and skeletal myopathy (CSM), and with distal myopathies. [provided by RefSeq, Jul 2008]

DES Gene-Disease associations (from GenCC):

• dilated cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• dilated cardiomyopathy 1I

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
• myofibrillar myopathy

  Inheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
• myofibrillar myopathy 1

  Inheritance: SD, AD, AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
• atrioventricular block

  Inheritance: AR, AD Classification: STRONG Submitted by: Genomics England PanelApp
• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: MODERATE Submitted by: ClinGen
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• neurogenic scapuloperoneal syndrome, Kaeser type

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001927.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 2-219418976-CAGCGCGCGCGCGTCGACGTCG-C is Pathogenic according to our data. Variant chr2-219418976-CAGCGCGCGCGCGTCGACGTCG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 16823.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001927.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DES	NM_001927.4	MANE Select	c.521_541delCGCGCGTCGACGTCGAGCGCG	p.Ala174_Arg180del	disruptive_inframe_deletion	Exon 1 of 9	NP_001918.3
	DES	NM_001382708.1		c.521_541delCGCGCGTCGACGTCGAGCGCG	p.Ala174_Arg180del	disruptive_inframe_deletion	Exon 1 of 9	NP_001369637.1
	DES	NM_001382712.1		c.521_541delCGCGCGTCGACGTCGAGCGCG	p.Ala174_Arg180del	disruptive_inframe_deletion	Exon 1 of 9	NP_001369641.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DES	ENST00000373960.4	TSL:1 MANE Select	c.521_541delCGCGCGTCGACGTCGAGCGCG	p.Ala174_Arg180del	disruptive_inframe_deletion	Exon 1 of 9	ENSP00000363071.3	P17661
	DES	ENST00000942906.1		c.521_541delCGCGCGTCGACGTCGAGCGCG	p.Ala174_Arg180del	disruptive_inframe_deletion	Exon 1 of 10	ENSP00000612965.1
	DES	ENST00000942898.1		c.521_541delCGCGCGTCGACGTCGAGCGCG	p.Ala174_Arg180del	disruptive_inframe_deletion	Exon 1 of 9	ENSP00000612957.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Desmin-related myofibrillar myopathy (2)
-	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.7
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60538473; hg19: chr2-220283698;