rs60538473

Positions:

• chr2-219418976-CAGCGCGCGCGCGTCGACGTCG-C

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP3 PP5

The NM_001927.4(DES):​c.521_541delCGCGCGTCGACGTCGAGCGCG​(p.Ala174_Arg180del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: DES NM_001927.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1 O:2
• Conservation: PhyloP100: 9.72

Genes affected

DES (HGNC:2770): (desmin) This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane. Mutations in this gene are associated with desmin-related myopathy, a familial cardiac and skeletal myopathy (CSM), and with distal myopathies. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001927.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 2-219418976-CAGCGCGCGCGCGTCGACGTCG-C is Pathogenic according to our data. Variant chr2-219418976-CAGCGCGCGCGCGTCGACGTCG-C is described in ClinVar as [Pathogenic]. Clinvar id is 16823.Status of the report is no_assertion_criteria_provided, 0 stars. Variant chr2-219418976-CAGCGCGCGCGCGTCGACGTCG-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
DES	NM_001927.4	c.521_541delCGCGCGTCGACGTCGAGCGCG	p.Ala174_Arg180del	disruptive_inframe_deletion	1/9	ENST00000373960.4	NP_001918.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
DES	ENST00000373960.4	c.521_541delCGCGCGTCGACGTCGAGCGCG	p.Ala174_Arg180del	disruptive_inframe_deletion	1/9	1	NM_001927.4	ENSP00000363071.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1 Other:2

Revision: no assertion criteria provided

Submissions by phenotype

Desmin-related myofibrillar myopathy Pathogenic:1 Other:1

not provided, no classification provided	literature only	GeneReviews	-	- -
Pathogenic, no assertion criteria provided	literature only	OMIM	Jun 01, 2009	- -

not provided Other:1

not provided, no classification provided

literature only

Epithelial Biology; Institute of Medical Biology, Singapore

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs60538473; hg19: chr2-220283698;