rs606231188

Variant names:

• chrX-19358911-C-CATAGTTACCGTACACGAGAAG
• rs606231188
• NM_000284.4:c.900-3_917dupTAGTTACCGTACACGAGAAGA

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP5

The NM_000284.4(PDHA1):​c.900-3_917dupTAGTTACCGTACACGAGAAGA​(p.Glu305_Glu306insAspSerTyrArgThrArgGlu) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 23)
• Consequence: PDHA1 NM_000284.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: -3.78
• Publications: 0 publications found

Genes affected

PDHA1 (HGNC:8806): (pyruvate dehydrogenase E1 subunit alpha 1) The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]

PDHA1 Gene-Disease associations (from GenCC):

• Leigh syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• pyruvate dehydrogenase E1-alpha deficiency

  Inheritance: XL, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet, Ambry Genetics
• Leigh syndrome with leukodystrophy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 4 uncertain in NM_000284.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000284.4.
• PP5: Variant X-19358911-C-CATAGTTACCGTACACGAGAAG is Pathogenic according to our data. Variant chrX-19358911-C-CATAGTTACCGTACACGAGAAG is described in ClinVar as Pathogenic. ClinVar VariationId is 10877.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PDHA1	NM_000284.4	c.900-3_917dupTAGTTACCGTACACGAGAAGA	p.Glu305_Glu306insAspSerTyrArgThrArgGlu	disruptive_inframe_insertion	Exon 10 of 11	ENST00000422285.7	NP_000275.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PDHA1	ENST00000422285.7	c.900-5_900-4insATAGTTACCGTACACGAGAAG		splice_region_variant, intron_variant	Intron 9 of 10	1	NM_000284.4	ENSP00000394382.2

Frequencies

GnomAD3 genomes Cov.: 23

GnomAD4 exome Cov.: 20

GnomAD4 genome Cov.: 23

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Pyruvate dehydrogenase E1-alpha deficiency Pathogenic:1

Jun 01, 1998

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-3.8
Mutation Taster		=100/0	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs606231188; hg19: chrX-19377029;