rs606231188

Variant names:

• chrX-19358911-C-CATAGTTACCGTACACGAGAAG
• rs606231188
• NM_000284.4:c.900-3_917dupTAGTTACCGTACACGAGAAGA

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP5

The NM_000284.4(PDHA1):​c.900-3_917dupTAGTTACCGTACACGAGAAGA​(p.Glu305_Glu306insAspSerTyrArgThrArgGlu) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars). The gene PDHA1 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 23)
• Consequence: PDHA1 NM_000284.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic/Likely pathogenic no assertion criteria provided P:2
• Conservation: PhyloP100: -3.78
• Publications: 0 publications found

Genes affected

PDHA1 (HGNC:8806): (pyruvate dehydrogenase E1 subunit alpha 1) The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]

PDHA1 Gene-Disease associations (from GenCC):

• Leigh syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• pyruvate dehydrogenase E1-alpha deficiency

  Inheritance: XL, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics, Orphanet, G2P
• Leigh syndrome with leukodystrophy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for PDHA1 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 9 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 8 uncertain in NM_000284.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000284.4.
• PP5: Variant X-19358911-C-CATAGTTACCGTACACGAGAAG is Pathogenic according to our data. Variant chrX-19358911-C-CATAGTTACCGTACACGAGAAG is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 10877.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000284.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PDHA1	NM_000284.4	MANE Select	c.900-3_917dupTAGTTACCGTACACGAGAAGA	p.Glu305_Glu306insAspSerTyrArgThrArgGlu	disruptive_inframe_insertion	Exon 10 of 11	NP_000275.1	P08559-1
	PDHA1	NM_001173454.2		c.1014-3_1031dupTAGTTACCGTACACGAGAAGA	p.Glu343_Glu344insAspSerTyrArgThrArgGlu	disruptive_inframe_insertion	Exon 11 of 12	NP_001166925.1	P08559-4
	PDHA1	NM_001173455.2		c.921-3_938dupTAGTTACCGTACACGAGAAGA	p.Glu312_Glu313insAspSerTyrArgThrArgGlu	disruptive_inframe_insertion	Exon 10 of 11	NP_001166926.1	P08559-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PDHA1	ENST00000422285.7	TSL:1 MANE Select	c.900-5_900-4insATAGTTACCGTACACGAGAAG		splice_region intron	N/A	ENSP00000394382.2	P08559-1
	PDHA1	ENST00000947567.1		c.1098-5_1098-4insATAGTTACCGTACACGAGAAG		splice_region intron	N/A	ENSP00000617626.1
	PDHA1	ENST00000947577.1		c.1059-5_1059-4insATAGTTACCGTACACGAGAAG		splice_region intron	N/A	ENSP00000617636.1

Frequencies

GnomAD3 genomes Cov.: 23

GnomAD4 exome Cov.: 20

GnomAD4 genome Cov.: 23

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
2	-	-	Pyruvate dehydrogenase E1-alpha deficiency (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-3.8
Mutation Taster		=100/0	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs606231188;

hg19: chrX-19377029;